Description :
From Genome Similarity Track
Location :
Scaffold_9:150418- 155397
Sequence
4979 bases(100 bases per row)
TACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGGTTCGTGGAACTAGACGATGACATAAGGGCTCGTCATATCGTCGATGAGGAAATGAAGATCGCAT
TTGCTCAATCGAACATGGCAGGACGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTTGTTGGAAGTCTTCAAGTCCCT
GCTAAGGCAAACTTTTGAGCCTCCGCGAGCTGAGTTCAGGTCTCGCTCTGAACTCCTGAGAATCAGGCAAGGTAAACGCGACGTACACTCGTACATTCAG
TACATACGTCACCTTACCAGTTGCATAACATTCAGCCCACTGAACAAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAA
CCTACCTGTTCCGATTGGAGTTCAACACCCTCGAAGAGGCAATAAGGGTTGCGGAATAGGAGGACTTCAGCGTGAAACAGTCTCACGCGAATTTAAATTC
CTATCGTCCATCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGCAACGCGAGGAGTGAGAGCTCTCGTGTTAACAATTACAAGAAATTG
CAAAAATGCAATAGATGCCAGAAGACAGGGCATTACGCATATGAATGCAGTGCCTCGAGCGCGGTACCACGTACCGTAGGAAACAGTAACCGCCAAGCGG
CCAAGAGAGTTCGAAGGCGTGGGTCCGACGTTGTTGCGAAAACGCAACAACGTAACGGACAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGAGCACCCT
ACTGATCCAGCAACGTCATGTAAGTTTGCAGGCCTCTTGACGAAATTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCC
TCATTACCTTGAAACTCGAAGTGACACAAGGCATGTCGCTTCGAGCTCTAGTCGATTGTGGGGCGTCAAAAAACTTTGTACGACGCCAATCGCTAGACAA
TAGCGAGCTCAAATATATCGAGCGCGAGATCCCTCCAACGAGGATGACGGTGCGCCTCGCAACAGGAGCATCCGTAACAGTGATGAAACGTGTAGTGGGT
ATTACCTATACACTGAAGGGAGTCCAATATAATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATATCATTCTTGGACTGCCGTGGCTCAGAA
GGTACGAGCCACAAGTCAGCTGGCATCGACGAACAGTTGATATGCTTGTCACTTGTTCATCAGATGGCCATCTGATGAATGCCATGGAGCGCCCACTAAC
ATGTGGGTGTACTACGAGCGAGTGCGATGGCCTCGCATGTGGTTCGGTCAGTAGTACGACTACACATGGCCATGGAGTGGCTGATCGCTACCCCATGAAG
CCATATTCCGGCGACTGCATTGAGATGCAGATCGTGCCGAAGGCAAGCCACCCGAATAAGTCGAGTGGAGTGGGGCATGGGTGTCCTTCAAACGGACAAC
ACCCAAGTAAAAATGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCACACGTAGAAGACCTGGCCGCGGTAGCGCAACC
AACGCCGGAGGATAACGAGGGAGCAATTCCACTCGTGCCAGATGATGAGGTAGCCATAGAGACTAGTGGGGGAATAAGTCCCCACCCAACTGTGGAAATA
AGTTCCCAGGAGACAACAGAGACATTAAATGTCCTAGTCAATGACGGATAAAGTATAGGGACATACCAACTTGATCTGATCGCGCCTCCAAGGACAACTT
CGGAGATCATTCAATTGCCCACGCTTGAACAGAAAAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACGCGTCGCGGAAGATTA
GTACGTAACCGATATTCGGTCGGTAATGGTATTTGCCGAGAACAAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTATACTTGATGAGAAGACTCGG
ACTAAGCGATACACATCCGAATCGTGGGAATCGCTCAAGACAAATCTACTCTACGATGATTTGATAGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGT
GCGAGCTACCCAAGGATAAGGGTACTCGTCACGAGATCGACCTGAAACCAGGTTCAAAGTACTGTGTCATGAAGCAATCGCCATTGCCTCGTGAACAAGT
ACTAGCGAATGACAAATTCTTTGCTGATCACTTGGCAGCGGATCATGTGAGGGAATCAACTTCCCCTCAAAGCTCTCCGACCTTCTGTGTCCGAAAAGCC
GCAGGAGGATGGCGGATAGTACATGCTTATAACAAGTTGAATTCTGGACTGTACTGGCTCAAACGCCGATACCAAAAAAAGATGTCATTATAGATGGTAT
GTTAAGGAGTACCATCTTTTCATCGATGGATATGATGGACGGGTTCTATCAGATCCTTATGCGCGAAAAGGACATTCCTTATACAGAAGTGAGTACCCCA
AGAGGTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAATAGATGTGTTACGAATCGGTTGAGATCAGTGCGAG
ACTTTGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGCTGGACAGACGGATTTGGAAGCCCACCGACTCCACATCCGAAAGTTTCT
TACACTGATGCGTGAGCAAAAGTTATATGCCAATCTCAAGAGGTGCATATTTGCTACAAGTGAAATACCACTTCTTGGATGCATTGTGTGTAAGCACGGC
GTCCAGATCGAAAAGACCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGGCCTAGCGGCGTATTTGCAAAAAT
ACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGCCAGCGCGCTTTCGAAGG
TATCAAGAAAAGCTTGATACGCTCGCCAGTTTTGGCGATTGCAGACCGAGACAGACCCTTTCATGTGGTCTGCGGTGCAAGTGATTTTGCCATCGGATGT
GCACTAATGCAGTACGACAAAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCAGCTGAACGTAACTACCCAGTCCATGACAAGG
AACTCCTTGCCATGAAGTATTCATTGGCAACATTCAGGATCTACCTACTAGGTGATCGACCCTTCATCGTATACACGGACCATGCGTCCTTGCGCACGGC
CGTTAACAGTCTACACCTCTCGTAACGAATGGCGAGATGGTTGTCGTTCTTCGCAGAGTATAACTTCTCCGTGGAATATAAAGCAGGACGACTGAATGTC
GTCGCTGATGCTCTTTCGCGCCGGCCCGATTTCGAACCGGTTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGACATGAGTGTCCCATCTTC
AACCTTATTCGAATCCATACGCAAGGCGTACGATCCGGCGATGGTGCGTTTGATGGATCATCTCTCGCAACCATCCCGTCAGTCCCTTAAAAGGTTGCTC
CCAGTATATCGATCCTCCACGGATGGATATACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCTTGTCGTCGTACCGGACC
ATGGTAACCTGCGACTGCGCATCATGTATGAATACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGTCATATCTCACAGTTAGTCGCGACTT
TTACTGGCCCCGCCAGTGTCAGTTCGTGCGAATGTACGTCCGCGCATGAGAAGTATGTCAACTAGTGAAGGCAGGTCCTTCACTTTGTGCTCCGTTGCAA
CCCTTGCCCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTAGGATTCCCGCAGACCCACACAAGAATACAGGTAGTCTTGTGGTCGT
TGATAGATTCAGTAAAATGGTACACCAGGTCGCTGTACCTGAATCTAGCAATGCATCGGCATGTGCTCGTGTCTTTATTGACACAATCTTTCGTCTTCAT
GGGTTGCCTCGTGAACTCGTCTCTGATCGAGATCCACGGTCCACTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGA
CCTCTGATCACCCTGAAACAGATGGTCACACAGAACGTGCCAACCGCGTTCTTGAAGAAATCGTTCGGGGTTATGTCCATTCGTTTACGAATTGGAGCGA
ATTCTTGCCAATGGTGGAACTCGCCATCAACAACTCGGTGCATGCATCAACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCAAGCCTGCCC
ACCTTCTTAAATTGTAACTATACTTTGGGGGGGAGGGACTCATTCGATCGAACGCCAACTCGGCTCTCGCTCATCACGTACTGACCACGAGGTCACTACG
TATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGACGAAAGTAAGAGTGAGGATGCTCTTACTTTCCAGGTCACTGATATTGCCACAGTGCGCT
CCAAGCGCACAACAGCCAAAGACGGCGTGTCAGCAGATGAATTCATACTGACTCGCGAAACGGTTGTCCGTTTCGTGCAATACTCCATTGCGGAAGCAGT
GGGCCGACAAAAGAAAAACGCAGACAAGAATGGAAGGGAAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCTACGGTAATCCTACCTCGA
CACATAGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCATAGGCAACGCATACACGATTGAACTGC
CACGTGAGATGCGCCCGCATCCTACGTTCTACGTTGGTCGCCTTAGACCTTATCACCAGTACGGAACTTCTTCCGGTGA