Description :
From Genome Similarity Track
Location :
Scaffold_74:150413- 177860
Transcript NameFunction/comments
Phyci_94754HECT ubiquitin ligase, putative
Phyci_94755Hypothetical protein
Phyci_68194Hypothetical protein
Phyci_232876hypothetical protein
Phyci_10622conserved hypothetical protein
Phyci_82725amino-acid acetyltransferase, putative
Phyci_94761Hypothetical protein
Phyci_82728Hypothetical protein
Phyci_232853conserved hypothetical protein
Phyci_232902conserved hypothetical protein
Phyci_232818GMP-PDE, delta subunit family protein
Phyci_10629nardilysin, putative
Phyci_94765Hypothetical protein

Sequence
27447 bases(100 bases per row)
GCTGTTTACAATAGGTTTGTGTTTGATACTAGAGTTTTAAGCTCCACGGAAGTAAAAATGTGGTGCCCGATGATGCCGACGTTATGCTGTCGTGAAACCC
GTGAGATCGGTGTCGAGGGTGGCGTACAGCATGTTCTTCAGCTCCTTCTTGCTGTGATACAGCGGCAAGTCCAGTCGGTTGAAGCACGCATGACTCGAAA
TGTACTGCGTCGTTCGGTACGGCACGCCCTTGAGGGTGAATGGGCACAGTCGGCCGTCGTAGCTAGTGAGGCCACCAAAACCCGACAGCGGGACGCAGGC
AGATCCCGTCGCGAACAGCAGAAGGCGCCGGCGGTACTCGTTCGGCATTTGCCTAACGATCTCCCAGAACCAGCGGGTCACGGTAGCACCCTCAAGATTG
GGGGATTGCACGGTGTGCGCCTCCCAGTCCGTCACGTCAATTTCGGGGGAGCCGCACAGCAGGTAGTCGAACTCTTCTGCGTCGAAGGTCATCAGCATAT
CGCGTGGGATGATTTCGTACAATCCCTTCAAGAACGCGTACATCTGGTCTGCCACACTCTCGAACAGCACGTATCGGAATCGGCGGTTCAGATATTCGCG
CTTGTTCGCGTCCGTGACGGTCACGTTCCGTCCATGGGGAATCAGGTCCACCACGACCTTCTCGGAATCGTTCACTTGCTCGATGATACTGAAGTCAAGT
CCAAGATCGTCCACACCGTCGTTATCCATTAACCACTGCAGACTGCGGTAGGTTTCTGGGTCGAGGAACTCCATGTCGGCAAAAGTGACCGGCATGCCCA
AAATTATCTTCAGCAACGGCAGAGCCAAATGAAAGCCCCAGATTCCACCTTCCAGCAGTGCCCGGCCAATCAATCGACCAGTGGCAAAGTAGTAGGCCAG
GTGGTCCTCACCCACCTCGGCAAGCGACTGCGGGTTGAGAAAGTAGCTCTGGTCGGCTTTGTTCGTGCACTTAAACAGTTGAAGCGTCGGCGACGCCAGC
AGCTCGTTCACGAGCATGAACCATTCGCGGTGCACGCCACCAGCGTCGACGCCACTTTCGTCCAGAAAATTGATGCGCATGAAAGAGCGCAGGTTCTTCG
GCTGAATGCAGTACATGTGGTCCATGGACTCCTCAAGCATGTAGTCGCGGTGCACCGACAGCTTGAGGAACTCCACCTCCGCCGGCACGATCAGCGACGC
CGTGCTGACGACAAAGTGCGCATACTTGGATGGGAAGTCGCTCTCCGCCAAAGACACGGCCTCCTTCCTCCTCTCGGCGCCCGCGTGCGCCAGCTTCGCC
TTGCCCGTGGCAAACTCGGCCGGGTCCGACGCGGACGCCTCCACCAGCTCCAGCTGCACGTCCGTGGGAAGCTCAGGCTTGGGCTCGTCGGCGTTCTCCT
TGTCGTCCTTCGGCTGCTCCACAGTCAGCACCAGCTCCGTGTCCGCCGCCTGCTCCTGCTCCGGTGGTTGCTGCTGCTCTTGTTGCTCTTCGTGCTCACT
GGTGCGTTGCTCCACTTGCTGTTCTCCGTcttctccttcttctccttcttgctcttcccgcttctcttgctctccctgcttctcttgctccttctcctCC
GGAAACTTGAACCGCACCGTGTATCCGGGCATGAGCGCGTCCGCGTCGCTGCTGGCCGGCAGGTTGCCGCCGCCGCCGCTTCTGTACCAGAAGAAATTGC
CTTCCACGTCGAGCTTGCGGCTCCACTCGCGGCGGTTCCGCGCGCGGCGCTGCTGGCGGCTGAGCGACGACATCTTGCGCGGCCGCGGGGACAGCAGCAC
CGACGGGCGCGCGTCGCTGGCCACCACGTTGACGGCGCGCGCCGACGGCTGCTCGTCCTCGTCGCTGCTGCTGCCGCCGTCGTCCTCGGCCGTGGCCATG
GACAGCGACGGCAGCTTGTCGCCGCACAGCACGCAGTAGTCGAAGCGCTTGAAGTTCTCGAACTCGCAGCTGGCGCACACCGTGAAGCCCGCCTCGGCCT
CGCGCGTGGCGGCGTCGATGCGGTGGTCCACCGACTCGCCCGAGAGCAGCGGCACCTCCATGTCCAGCAGGTGCCGGTTGCGCCGGCACGCCATGAGCCA
CACCACGAAGAAGATGACGCACAGCAGCAGCATGCCGATGCCCTGGTACAGCATCGACGCCTCGGTCGTGGTCCCGTCGCCGTCGCCGTCCATCGTTCCG
TGCAGTCCGGCGAGTCCTCGAGTGCGAGAGCGTTCGGGCGTTCGGCCGCCGGTGATCGAAGACTGCAAGTCAGTCACACGCTCAAGGGATCTGCCCATCA
CTCTCCACATACAAAAGGCAAGTCACGACCCAGCTGCTGCGATTCGCTACGGATTCCGTCGGATGGGGATTACGCAGACATTCGTTGAAGCGACATTTTG
CCAGCAGCCCTAGCGCGAAACATTAGTGCGCGGTTTGCTTCAGACCTGCTGGCCGGCCTGTCGCCGCTGTGCTGTTTGTTCCAACTTGCAGGTAGCCCCG
CCTCGAAGTGAGGTTGCATCCCAAGTCGCAAGTTTGACTGCTTTCAGGTTGAACCGCACGGGACCTGCACCGCACTTGCCCTCTCCAATATCCACAGCTT
GTGATTATGCACCCTTTACCTAGACCTCTCGTCCAGAGTCTCGATGACGGCAAAGCACTTGAAGGCACTCGGTTTACGTTTTGCCGGGGGTTGGCTTCCC
ACCAGCAATTCTGCTGCAGCTTCGAGTGCTGCGTTTGGCATGTACCCTTTGCACCGGAAACTTTCCAGTGGAAAGCAGAAATACAGCACCAAGGCGGAGC
TCCTGTTCGACGAGAACAACATGCTGGCAACATTGCTGCTGTTCCGGAACGCCCTCTGTTCTCGTAGTCAGCGACAGGATGTCTTCGACAAAAGGCCCGA
CATTCGGAAAAGCGATCAATCCTGCTGTTAGCGATTCTGAGAGCGATTGGCGTGGCGTCGGGATTTTTTCAATTTTTGATGACGACCAAGCGGCGTCTTA
CGTTGTCGCAAAGCTTGCGCTGTTGCTGCGAAATTGTACATGTACCAGATTCCCGGACTTCCTGTATCCGGGTGATCCGCACTGCAAGGTAGCATTGCGC
CAGCAAATAATGTTACTACGCGAAGAAGTCTACGCTGTTGACTACGCTGTCGTGAACCCGTACGTCTCCGTGCTGAGGGTGGCGTAAAGCACCTCCTTGA
GCTCCGCGCGAGTCGATGCAAGCGGCAGGTCTAACCGGTTGAAGCACGCGTGGCTTCGGATGTACGCAGAGTGCACGCCCTTCAAAGTGAACGGGCAGAT
CTGACCGTCGTGGCTGGTCAGGTGTCGGAAGCCCCCGATCGGCACTCGCGAGCACCCTGTAGCAAACTGCAACAGTCGACGGCGGCACTCGGGGTTCATA
TCTCGAACGAGCTCCCAGAACCACCGAAGAACTCTCGTCCCCGTCAGATTTCTCGAGCACCTCGTATGTAGCTCCCAGTCCGCCACGTCGATGGTGTCGC
AGCCACATAGCACGTAGTCGAACTCTTCCACGTCGAAGAGCATGAGAATTTGCCGCGGAACCACTTGGTACAAGCCTTTCAGAAATACGTACAACTGGTC
TGAAACACTCTCCAGCAAGAAGTAATGTAGCCAATGCTCCGCAAATGAGTGCTTGTTGGCATCCGTCACCAGGATGTCTCCTCCATTTGGCACCAGCTCC
ACAGTCACCACATCACCCTTTGCACCCCTTCTCGATGCCGTGAAGTCTAGCCCTAGCGTGTCAGCCCCGTCATTTTCCAGCATCCACAGCAGACTTTTGT
ACGTTGTCGGATCTAAGTCCTCGTAGTCGCGGAAAGTGAGGGGAATGCCAAGGGCGATTTTCAGTAGTGCAGGTGCAAAATGAAAACCCATAACTTCACC
ATCTAGCAGGGCACGGCCGACGAGACGCCCCACTGCGAAGAAGTACGCGAGGTGCTCCTCACCGATCTCCTCTCTAGAGTTTGTGTTGAAGAAATACGTC
TGGGATTCATGATTTGTACAAGTAAATACGCCCAGCGCTGGATCAATCATCAGCTCCGTCACAAGCGTGAACCACTCACGATGTACACCGCCAGCGTCTA
CAGCAGTCTCATCTGCAAAATCGATTCGCACCACCGCGCGAGTATCGTTGTCATCCATACAGCAAAAATATTCCATCGATTCTTCCACCACGTGTTCGCG
ACGCAGGAACAGCTTCAGGACTTCCAACTCTGCTGGTACAATCAGGGAGGAAGTACACGTCACAAAATGCGCGAACTTCGTAGGGAAGTCTTCTTTGGAC
AGGTCTAAGAATCCCTTGATGTCGACGTTCCGTGACGAAGGCGCCCCGGTCGCGAACTCGAGGGCGCTCGCTTGCTCCGCAGGCACGATCTGGATTTTCA
TGAGCCTCGTCTCATTCTGCAACCTGGCAGTCATCCACCCAGGCTCTCCATACGGCGGCTCTACATGTAGAACCCCTTCCGCTTCTGCTGCTTCGGCACT
GTCGCCTGCTTCTCTATAGAAGACAGGCACGTATCCAGGGTACTGGAAACACTCCTGGGTCGCCTCACGGTGCCAAAAGACCTCTCCACACTTCATCTCA
CGCCGCCACTCCGACCGACGCCTACTACCCAGCATATAAACACACAGTGCAAATAAGTACTGGTCACGCCACAGCCAACGACCAAGTGCCGACCTCGCAC
GCAGCTGTCGCGCAGTGAGCGGGCTTCTCGCTCGCGCTCTCTCCGTCGGCGACAGCTTCAGCTTCTCGCCGCAAAGGACGCAGAACCTGAACCGCTGCGT
GTTGGCGAAGGCGCACACTCGGCAGCGCACGACCTCCTCCTCCGCCTCTCTGTAAGGCCCAAAGGCAGCACAACCCCGTCCCAGTCAGCACCGTGTACTA
GTCAAGTGTCAACACTCTCTCCACGCACAGCGTTGCAATGTCGACGCGGTGTTCCCCAGTCGCTTCCTCCCTGCAGCGAACACCCACACCACAACAGTCA
GATACTGCCCAGCACCAGCCCACAGGTTGGAGCAGCCGCGGCCTGCCTGGCGATCAGCGCCTGCTGCAGCTCGCTGACGCTGCGCTGGCGGTACTTGCGC
TGCAGCGCGCGGAACATGTAGGCGATGAGCAGGTACAGCGTCACCTGCGAGGCCACGATGAGCAGCACCAGCAGCTCCGCCATCGCTCACTCGCCTCTCT
CTTCCGGAGCTTCTCGCTCGGCAGGCGGCTTCAACTCGAGCATAATCACCACTTTCGACCGTCACTTAACTGAATGTCTTACATGCTGTATGTGCCACTC
AACCGAGGTTATTGTTGCTCCTCATTGACTTACACAATATACTCGACCATGAGCGCCGCGCTGAGCGACAAGAGCGCGCTGGTGCTGGAGCTGGGCGCGC
GCTACGCCCGCTGCGGCATTTCCGGTGAACGCGCACCTCGCTGCGTGACGCGATGGGAGGTGCGTGTGCCTGCTAGCGTCATCGGTGCTGAGCGCCTGGC
TGCTGATACAAGCGTACGGATCCGTGTGTGACCAGGTGGGCGACATGCTGCTCAAGCCCCTGAGCGCCGCAGACTGGCGCCAGTACCTGTACCCGAAGCT
GCACGCCCTGTGCTTCGAGTGAGTCGCGGTGGTTCTCATGGGTTGCATTGGTGTTGGGGGAGCTGACGCTTTGCAGTCTGCTGCTGGTGAATCCGACGCG
TCGGCGCTTCGTGGTGTGCGAGGATCTGCTGCTGCCTCGCGTGTTCCGAGAGACGCTGCTGAACCTGCTCTTCGATGTCATGAAGGTAGGTGGTCGTCGG
GTTAAGGGTGGTGGGTGGGTGGCCTAAGAGTGTATTTTGCTTTAGGCGTCTGCGGTGACGTTGGTGCCGTCGATGCTGGCAGTGCTGTATGCTACGGCCA
ACCACACGGCGCTGGTGGTGGACTGTGGGTGGGCGGAGACAAGGTTGCTTCCGGTGTTCAAGGGCATCCCCCTGCCTTACCTTTATGAAAGTAAGGTCTG
AGTACGATTATTGTTTTGGGGGGGTCGGCAATACTGATGCCTTTGCTTGTGTTTGCTGTAGCTGTACCTGCTGGAAGTCGGATCTGCTGCGAGCTGATTC
AGAAAGAGCTTAATGCTGCTCAAGACCAGCCGATGGATGGCTCTAAGATCGCCTCGCCAGTGACGGAGGCAATGGCAGAGGACGTCCTTGAGCGGGCGTG
CTTTGCCCAGCAAAAGGTATAGCACTGAGTGCAGCTATGCTGCTATGGTGATGTTTTGTTTGGGCTAACGTTGTGCTTTAATGCGCAGGATCCACTACCA
AATGTTGTCGATGCGAAGTTTCAGACCCACGATAACGATGTGCTACAGGTCGGTTGTCAGCAGAAAATCAGGCGCTGCTTGCGCAGAGATATTAATTGTA
AAGCTACGTGCGTTTCTGTTAACAGGTCCCTGGTAGTCTGCGCACAGGAGCTGTGGAGCAATTACTGCTAGGTATGTTTTTTTCTCATTGCCTGCTGACC
CACAGTACTGTGTGCACTAATCATTCGTGTCCTATTGTCGCGCAGGCGATGAAAGCACGGATGGAAGCTCGATTGTCGACGGCATTGTTCAAGTGTTGAA
GAAGGCCCCGCTTGACGTGAGGGCTGCAATGCTGGAAAACCTGCTCTTTGTTGGGGGAACCGCTATGATTCCAGGTAGCTAGATCTCGGGGGGGGGGGGG
TAATTGTTGGTCGCTGTGCTGATCTATTTGATTTGTTTTTATTTGTTTGCCAGGCTTGGCGCATCGTATCGTGGCTGAAGTCCGGGAGTCGCTCCATCAC
GACAACGAATTCGCTTCTGCCTCAGTTGCTGTAGACCGTGCACAGCTTGTTCAAACATACTTCCCTCGGAATGTGCTTGCGTGGGTCGGTGGCTCAATTT
ATGCCGCCACTGAAAGCGCGCGGGTTTCGGCGATTTCCTCGCAAGAGTACAGTAGCTCGGGAGGCACCAGCATCCCCGACTGGCTCACTGTTGCCGACGA
TGAATTTTAAAAGTTTGCTGAGCGCCAAGTTGAAAGTGAAGAATGGTTGAAAGCTAAGTGTATTTCCTACTTCCGGAATTGCTCACTATGAGGATTCGAT
ACATCAACTATCATGGCTTGGTAAGTGGTACGACTTCAAGTATCAAGATCGCATCGTGCTTCATTTGTGCGCAATACTATCGCGCTAGCGGTCAATGGTT
TAGTTACTTGCTCGTACGCATTCCGAGTGGTTTTCCGGTATCATCCCATGGTGCCTTCATATTAAGATCAGGCATGCCCTTCAGGGTCATGGTTGCACCA
CTGGGCCGTTTCAATGGGGCAACGTGATGTGGTAGCGCAGACTTGCGCGGCTGCATCTCTTTCACCACCTTTGCGTCTGAATCTCCCGGTGATTTAACGT
CTTCCTCACGCCGCTGTTCCTCCTTGGAGTCGGCTCGGAATTGGCCCTTGTTACGAGAAGTGATGCAGTCGACTGCTGCTGCGTCTTCCTCCTCGTCCTC
GTCGGTGAACTCATTCTCGACCTTCCATAGACTAATGCGTCGCAGCTCGTCACACCCTCGCACACCATTGCGGTACGTTTTCAACTGAATGCCCTCCTTC
TGCAGAGAAACGTCTGGGAAATTGGTGTCTAGCAATGGCTGCTCTTCCTCACCATTTTCGAGATAGACGTAGAAAGTGTAGTCGTAGTAAAGCAGCACAA
GCACAACGCCACCTACGTGAATCTTACTCGCAATCGCCTCCACGTCCTAGAGAATAGCAAGAAAACGAGTGAGTGGCACGAACTGTTTTTCAACTCGTAG
TACTTTACGACTGTGAACTCACCTGGAATGCAGCGCACTTGTCCATTGCAATCTCGAAAAAGCACTCGACGTTATCATCCTCGAGCCAGCTTCCCACGTT
CCCTGTGCCGTTGACAAAGGATCCACCAGAGTGTGCCAAGGTCTGCACGAATTGCTCTGCCTTGGACATTTCCTCCTGTATGGCAGGAACAATTTCGGCT
AGATGCTCCATTGAGGGCGTGAACAGCGAAGTCGCTGGCATCTTGGACACTTCGCACATAAAGGTCTGCAGGCACAGCAACGAACACAGTTATGAATGCT
GTCGATGGCATGATTTAAGGCAATTCAACTTACCAGGGCACTCTGCTGCCGTCGGAGCATGGGAATAATGATCGGAATGTCGGACAATTCGAGCTTGGGC
CCTAGGTCAACGTGACCATTATAGCACCAATTACCGAATCGGAAGAGCACCTCGCGCAAACTCGGAGTATTCGTTGATCCCTCGGTACGAGGTGTACGCC
GGATGAGGAAGGTCTGGTTGTAGCCTGCGCCACTCACATCCTTGCACTGCACCTTTAGTGGTTTCGGAGGACTCTGGTGTTTACCGATATTCGCTGCCTG
CCACAGCGTCAGCTTCTTCATGTTGCTGAAGTCGTCGTCACGGTATGTCTGCAAGTGGATGCCCTGCAAATGAGCAGACAGATCTGGGAAGCGAACATCC
AGTAGCGGTTGCTCGCCGTCTGCCGCCTGCAGCACGACGTAGAAACTGCGTTGGTAGTAGATCACCAGAAGCACCAGGCCACGCACGAAGGTCTTGCTAG
CCACGATATCGATGCCGTCAAAGCACTCGTAGCCACCGCTTTGCAGCTCGAAAAAGGTTCTCGAGTTGCTGTCGTCGTCTCCATCCACCCACGAGTGCTC
CTCTGCAGCTTTCATCAACTTGCGCTCGATGCGCTCGCTCGAGAGCTCTGCGCCGATGAAGTCATACACGTCGTACAAAGTCTCCAGAGGTGCTGAGTAC
TGAGACGTCGCGGGCATGGCCTTCCACTCACAGAGATACTGCAACGAGGCTTGCTGCTTCTGCAGCGCTGGAACGACTACCGGCAGGTCGGCGAGCTCCA
GGTCGGCACTGCCCAAGTCGACCTTCCCGCTGTAGCACCAATTCCCGCAGCGGAAGAGAACGTCATGGAGGTTGTTCTTGCTGGACCGGACGATGTACGT
CTGGTTGTATCCGTGACGAAGGGCCACCACCTCGGGCGTCGGGGCTCCAGACTCGTCCGCGCTGATGTCGGCCTCGTCGGCCAGCGCCTTGGACGGACGC
TTGTGCATGGTCTGAGTACGGTCGTCCTCGCCTTTGGCTTCCATCGTCGCTGTGATCACGTCGACTCTCAGGTGCTTGCCTACCGCCGTCGAAACTGCTC
CACTGAGCGCGTGCTGGAGGAACGGAGGGGCGCGCGGATCAAGCCGCGTTTCGGTTGTGAAACCATCGCGGCAATTCGGGACGCGTCAAAAACGGATAGC
GGCGGCGCGGCAAAGTGTCGACGTCTCATGTTAGGCTACATATCTACACGAAGCTGTCGGTCGGTCTGCAGCGCAGCGTGACAGCATGCTGAACTATATG
CAATTCGGTCGCTCTCGGGGGTCATCCGTCTACCACTTGTGGGGTTGGGCCCATGCACCCGTGGGCTTCGCACCAGCAGGGGCAGCAGCAGCAGCGGTGG
TCGCCGGAGCTGCGGGTTTCGTGAGTGGCTTGGCCCACGCGTTTCCAGAAGAGTGGGTCGGCTGCGGGGGAGGGGCTGCCGCACCTCCGGGAGGCGGGCC
CCAGGCAGCCCCAGGAGGAGGAGGCGGTGCTTGGCGACGGCCGTGCGGGTTCTGAGCGCGCGCGTGGCGACCGCGCATAATGGCCTGGATCTTGGTTGCG
GCTTGCTTCTCGTTTAGCGGCAGTGCCTCCGGGAAGGCCGTGCCGATCTTCGTATCCTTGCCGCGGCCGAAACTGAAGCACTTGATGTTGCACAGGTACG
GCCCCAGCTGCACGTGGTTGTTCTCCTGGCCGTTGAGGTAGCACATCGTGTACAGCGCCATCTCGAACTCCGGGCTCACTCCGATCAGACTGCACCACAC
AAATTCATTGAGTTGGATGCACGATACATATACTGTAGTGCAATAAGGCGAAGGCCGACGCACCTCGTGGAAACGGGCTTCATCTCGTCTTCCCACTGGA
ACTGGAAGGTAATGAGCTGTTCCTTGTTGTGAGGTTCCATGAAATTGCACCCACGCTGCTTGGGGCGGATGTAGCCCCTGTAGTCGATGCGGCCGTTGCG
CTCCTCATTGTAGACCTGCAGCCAGTTGTGGCAGCCGCAGATCTTGCCCTGCTCAGCGACAGCCGCACACAATGCAATCCGTCAGCTACAGCACATACCG
TCTAAACAACAGAAAACAAACACCGCGGCCTCACATTCTTCTCCTCGCCCACAAACACGTGCTCGAAGCCCGACGAGTCGTTGCGCACCTCGCGCCGGTA
GAGTCCGAACCAGATAAACTCGAGCTTCTTCTTGAAATCCTGCAGATCACCCGAAAACTTCTTGTTCTTCACCAGCCAGCTGCAATGGCAACCACGCTCA
GATGCAGCAATTGCACAACATGTTCCAGCCAACAAAGTGGACGTACGCGTGCGCATAGCGCATGGGCGCCGTCTCGAGCACGGCGTTCAGGAACGCGTTG
TTCTCAGCCAGCTCCTGCGGCGTCACCCGCTCCGGGATTCCAGTCTGAGCGGCCGCGCCAATACAATATCAGCAACACAAGCTCACAGTAACACAGCCAG
CTGCAACCGCCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGGCGCTCGAAGACGCTCGGGTCCACGAAGGTGAAGAGC
GGCTCGCTCGCCACATCGCCACGGGCGTAGGCGGTCTTGCCGGCCTGCAGGTTCAGCTCGTAGTGCACGTTGGGCTCCAGCCGGTTGGTGTCCAGCTCCC
AGAGCTTGTTACACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCACACGCGGCAGCAATCGAAGGCGTCAGCGTTCCTCCCTGCAAATCACATGAAGG
CGTTGCTTTGCGACGTACAGGTTGGGGTGGCGCTGGTCATTCTGCGGGCTGCGGGGCGTTCGGGGGTCTGCAGGCGATCGCGGAATGAGGAAATGGCACA
CGTCCAGCAGCGGATACTATCACCCACGCTGTCGTCAGTCGGCGCTGGAGCAAATGATACAGCTGGCTCAGCCAATCACCGGCGTGGGCGACGTCGTGCC
ACCGGAAACACTGCTGCCAGAAGTTCGACGTACACACTATGGGCCCGAAGGCTACAGGCGGTTGGATGTGTACACGTTATGGCACCGACCGCGGATCTTC
AAAGATACTTTTTTGAGCTGGCCTTGCGTTTCGCGTTTGATCCGCTGGAAGCACGGGGCTTAGCAGCTAAGAGTCTTAGCCTAGGACTAAGCTGATGGCG
TTCGCCTTTCCATAAGCATAAGCATAAGCATAAGCTGCGTGTTGCTGGGGCCAGGGCAAGCGCTTGAAACCTTGGTGCAAAGGTTTATTCGCCAATTTTT
TTTGTGTCAGTGCCCAGGAAGTGAAGCAAGCGGGACGTGTTGGCGGCGACGCTTTTGTCGCTATGCTGCCGCATCGCAGCTGTCGTACTCGGCAGCAAAA
GCAACACGGATGGATGGATGCCTTGCAGGCGCGCTTCCTGAGCTGGGACGCTCCTCGACACCGAAATACAGGATCGAAACGCACGGAGGGTGCATGACGT
GCAAAGATGGATTTAGCCTGCGATGCTGCCCAAATGACATGGAAGGCCGAGTCTGCGGCAACGGCACCATGGAACTGAAGCAGCCGGTTTAACACTGAGC
GGCATCCCGGCACGATCGCGTGTTCCGCGCCACCTTCAACGCTACTGATTCCACCAGACCGCTGCGCCGCGCTTCCAGGGCTTCCGAGTGTGGTCTCCCC
ATGTCCTGCCTTTGCCTGGATGGCCCGAGCATTTTGGCAGCCACAGCATTTTGGCAGCCACAATAAAAAGCCCGCAATGCTTGCCGTCGTGGGGTTTCGC
CGTGTCCGTACCTATGTAACGGGCCTTCAACCCCCTCCACTCTCCATAACCTCGTATACATAATCTTCATTATATCACTTCCCTTAAGTAGAAGCCTCTG
GCATCCGATGCCCCTGGCAGACCGCATGCATGTCGCGAGCGGCTACGTGATCGGGTCGGCAAAAAAAAGACAGAGTGGTTTTGCCTCGGCCACCCACCTT
CAGCCTCGCGCGTAATGATGTGCCGGCCGCCGCCACACTCGCTCTCGCCTCGCCGCGCGCAGTTCCCCGCCCCGCCCTGCTGACCAAGCCCCCGCCAAGC
TCCATGTGGGTCCGTCCCGGCGTGCTGCACTCGCGCAGACTGCTCTTCTCGTCCGCCTGCGGCCGCTCGCGCTCGTCCCTGGGCAGTCTGCGCGTCTTCA
CGTCCTcccgcgcggcgctgcaggcggcggcggcgccctccgcgcccgTCAGGGAGCCCGTCGGCGGCGGCTACTCGCACGGCAGCGCGTCGCTGGCGGG
GCTCTCGCCGCCCTCGGACGACCACCAGGCCGCCTTCGCCGACTTCCTGCCCGTGGTGCCGGCCGAGTGTCTGCGCGTGCAGCAGCCGCCGCAGGCCGAG
CGCGGCAGCAGCGCCGCCACGGCCACCGTGGGGCCGTCCTCCTTCACCGCCATGTTCCGCGACATGTCGCCCTACATCAACTTCCACCGGGGCACCACCA
TGGTCATCCACCTGCCCGGCCAGCTCGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACGTTCGGCGTCAAGCTCGTGCT
GGTGGCCGGCTCGCGCCCGCAGCTCAACCGGCAGCTGGCGCTGCGCAAGCTCTCGCAGCGGTTCGACTGCGGCATGCGCATCACCGGCCCCATGGAGCTG
CAGTGCGCCATGGACGCGGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACCTGGGGCGCGGCATCGTCAACTCCCCCGGCCGAGCGCGCACCATCAACA
TCTCGTCAGGCAACTTCATCACCGCCCAGCCGCTCGGCGTCCGAGGAGGCGTGGACTTCAAGAACACGGGCGAGATGCGCCGTCTGAACGTCGAGAAGGT
GCGCGCGGCGCTCGACGACGGAGACATCGTGCTCATCTCGAGCATCGGCTACAGCGCCAGCGGCGAGGTCTTCAACTGCCTCTCGGAGCAGGTGGCCAGC
AAGTGTGCCGTGCAGCTCGAGAGCGCCAAGCTCATCTTCATGCACAACGGCGAGGAGCTGGTCGACTCGCGATCCAACTCGGTGGTGCAGACCCTCGTGG
TTGAGCAGGCGCAGCAATATGTGGAGTTGGCGCGCCAGAACCCGGATATCAGCGGGGACTTCCTGCTGTACCTGAAGGCGTCCATCAAGGCCTGCGTGAA
CGGCGTCAAGCGCTCGCACCTGGTCAGTCGACACGTGGATGGCGGCCTGCTGCAGGAGCTCTTCACCCGCGACGGTGAAGGTCTTATGATCACCAAGCAC
ATGTATGAAGGCATTCGCATGGCCACCACCAACGACATCGTGAGCATCATGCGTCTCATCCAACCCTTGCTGGACGATGACATTCTGGTGTCGCGCGACC
AGGAACAAATTGAGAGCAATGTGGACACTTTCACGGTTGTGGAGCGCGACGGAGCGATCATCGCTTGCTGCACACTGCAGCCGTACGAAAACAATTTTGC
CGAGATGGGCTGTGTCGCCGTGGACCCGACCTACCGCAACCTCGGCAAGGGCAACGCCATGCTGGGATACATCATGCGCAAGGCGGCAGCCATGGGTGTG
ACCAAGTTGTTCGTGATGACGACGCGAACAGCGCACTGGTTCCTGGAGCGCGGCTTTGTGGAGGCTACGGTGAACGACCTGCCTCCGTCGAAGCTGGCGA
AGGTCGACCTGAAGCGGAAGTCGAAGGTCTACATTTGCGACATCAGCACGAAGAAGGCTCTGGACGAGAAGGAGCTGCTTCTGCAGATGGAATAAGCCGG
CGAGCTACCAATTTTACGCTACGCTAGACCGACATTTTGACTATCGGTCAGCACCGCGATTGCTTAGAACGGAGCGAGCAGCCAGTTATATTTAAACTTT
ACAGCAAGCTGGACAGCAATGACCCTCGGTAATGCGAACTGCTCGGGTATTTCCTCCTAATCGTTCCCTGATGTCTAACTTCAACTGCTTCGGCGGTGTT
GACTTGCCTATTTGGCGAGACTGTCGGGTGTCTGGCAAGCATATCCCGTGTATCCTTGAAAACACGAGCACATTCCCGTTCTGTAGTCGCACAAGCCGCG
GTTGGAGCACTCGATAAGGCATAAATTCCCTGCGGCGCCTACGACGGTGCCTCCAGGGACTATCTTGCCCGTGCAGTTGGTTTCGTCTACAGTCGTGCCG
GGGTCGTTTCCAGTGGGGCAATGTCCTGTTGAAGTTGAACGTAGGCAGATCTGAGCACCAAATAAGTGCACTGCGCAAGTATTTGGACGTACGTTTCGAG
CAGTCTGCGCTAAAATACTCTGTGGCTTGCAGCTCGCCACTGGCCGTGCCAACAGCCCAGCCCGAGTCGCACACGCATCCAAAAATCCTGTCGGCGTCCC
ATGTGCTGGAAAACTGCGGGCGACAGGCGACAAATGTTAGCCAATTTGCTGAATCATCCTGCCAAAACTTTGTTCATGGACATACCTGCCCACCACCATA
AGTCGTTGGCGGAGAAATGGGCAATGCATTCTTTGCCGCAGCCATTTCGCTCATACTCAAGCAAGTTCCTCGATCGGAGCAGTCGTTGGGGCACCCCACT
GCATAAATTTCACGATATCAACAGTATTTGTGAACAACAACAAGCATACCCAAGATTTGGTGGGCTGATCCTTACTTCTTTGGCATGCGGCACCCTCAAA
CCCAGGGAAGCATGAGCACATTCCAGAACTGCGGTCACACACTCCCATGCCAGAGCACTCCACCAAGATGTCATGCGCAGTAGTAGCGTCCGTTGGAATG
GAACTCCAAGCATAGTCCGACGGACACACACCTGCATACAACAATATTGGTGAGCTCATCGTAACATAACACAACCAAACTAGGTACCTACGTGTAGTGC
AGTCTGGTGACTTGTAGTCAGCGATATCAGTCGGTGCTCCCCACCCAGTATCACAAATGCAGACCTTGGATAGCAACGTACAGGTTCCATGGCCACTGCA
GTCATTGATGTATGTGCAACCTTCGCCGCCGATTGTAGTGCTTTCCTCGATTGTGTTCCCCCCGGCATCTTTCGTGTGTACGATGAAGTTTCCAGTAGCC
GAGTTGGGAGGTGTAGTCACCTGATCAAACGTGAAGGAGAGACCAGTGGCTGAGACGATACTTCCACCTGCAATGACGATGGACACTGAACTTGTTGTCG
AGGAGCTCAATGTACTAGCACTCGGAATGCCGATCAGCGCGCTGATTGTGATCGGAGCAGCGCCAATACTGTAACCTGCAGGGAGAACGGCTTCGATAAA
GCCCCCGACAGGAATGGTGGCGACGGTGTCCAGCGTCACTGTAGCTGTAGTAAGTGTGTTGGGCGTCTTGAGCAATGGACGCACACGGCCGTACGTAAGC
GGCATCTTAACAATTGGAGTACCCGCTACTGTTGTCAGCTGCTCAAACAAGTTCCCGCCGCTATCGGCGATCGTCACTGTGTAAGACTCCCAAGTGGTGG
TGCAGTATTCTACGATGAACTGATCGCAGGAAGATCCGGGGTTCACGATGGTCTCAAGTGTGAAACCACGGCTAGTTCCTGGGGCGACTGCAGTGTTGCC
GATTGTCACGCGTATCTTGGTCGAGCTCAGCGCTGTGAATCCGGTGTTGATCGTGGGCAAGTTAATGATGTGACTAAGAGTCACGCTGCTGATGTCGAAC
CAAGAGGGAAATGTCACCTCGACTCGACTTCCTGGGGGTATGTAGGCCGAGTTGGCAAACACTACGTAGTAGTTCGTTGGAATTCCGGCGAAATAGGATA
CTGGTGTCAGCGATGCGGATGGCAGCGTTGTACTCGTGTAGGTAAGTCCAGGAACAATCGTGTTGACCTGGAAGATGGCCCCGGACGAATGGCGCGAGTC
GATGCCGAAAAAGCCTGAGGTCTGCGCCGCTGGATTGATAATGTTGCCGTACGTGATGAAAACAGTCGTCCCTGCAGCAATGTCTTGTCCGGCAATCGTG
AGTTTGACGTACGGGGATGCTACTTGAACAACCGTCGAAGCCACATTGATATTCACCAGGTTGGAAAGAGTCGCGCCCGCGAATACAATCTGGCTGTCGC
TCAGTGCTGGAAAGCTCAATGCAATAACGCTACCAACGCGTAACGTGACGTCGGTTGTGAAAGTGGCGGTGTAGGTCGTTGTCCTGCCAGCCACCAGTGA
CGTCGCTGTCACTGCTGCAGGGTTCGAGAAGGTCCATGTGCTGAACGTGGATCCAGCAACTGTGGCGGACTCTAGAGTCACGCCGCTTGCACTCGCAGTG
GTGATCAAGTAGCTGGATGTCGTGCCCTGTCCTGCACAATAACAGGGAACCTTCATCAGTCATCGCTACAGATTGAATGCCCCTCTTTTCACAGCTCGCC
CCACCCGGATTCTGGATGCCATCCAGCGTGAAGGCGATCGCTCCGGGGACAGCATCCGTAGTGGCAATAGTGATCGTTGCCACGCCACTCGCAGGCGTCG
ATACTAGCGTGCTGGTAGCGTCGATGCCGGAAGTAATGGTGAGAGTCGTGGACGCTACGTAGAACGTGGAGGGGAACGTGACCACCATGGTCCCGCCGAC
GGGGACGGTGGCGCTCGTCGTGAAGGCCACGTCCACAGTCCCAGTGACACCTGCAACCAGAGACGCCGGCGTGATGGACGCCGAGGAGATCGTTGCCTCC
GCCACCGGCACGCACGACAGCCAGAGCAGCAGCAGCCACCGCATCGCGCATCAACCAGCGTCCGTATCCTGCAGAATATGTATCCATCTGGAATACCCTT
TCAAGCTCCAAGTTTCAGATGGTTCCTGGAACTTTTGCTCGAGAAAATGCTCCTGGAACTCTTGCTCGAGAAAAGGGATCCTGGAACTTTGGTTCAAGAA
TTTAGCTTCTGGAACTTGATTCTGGAACTGGATTCTGGAACTCCGAAAACCGTTCGAGAGTTGCGGTCCTGGAATTAATATAAAAAGTTCGAGATCTGAA
CTCCTGGAACTTTGACAGCGTCATTTTGAAAAGCATCCTCGAACATTCGAGTGAACATGTGGCGTCGAGCTGTAGTGCGTTGCGCGTCGCAGGCGCTGCA
GTCATCGCGCGCTGCGTCCAGGTCGCTGCCGTCTCCAGCTCTGCGTAGAGCGTCCTTCTCTCTATCTCCGCTGCTGCGAGCGTCCAGCGCAGCGTTCCCG
CCGTGCCGTCACCACCGCCACAGCCGCTGCTTCGCCACTCAGAGCGACGACAACGACAGCGACAACGACGCTCCTGCGTCGCCTGCAACGTCCAGCAGCG
AGTCCGCCGCCGAGTCCGCCGCCGACTACTCGGGCGCTCCGGGCGTGGAGAGCCCCGGCGACAAGTTCGTCATGGTGTACACGTGCAGCGTGTGCGAGAC
GCGCTCGGCCAAGACCATCAGCAAGCACGCCTACTACAAGGGCGTGGTGCTGGTGCGCTGCCCCGGCTGCGAGAACCTGCACCTCGTGGCCGACCGGCTC
GGCTGGTTCGAAGACGACAGCACGGACGTGGAGAGCCTGCTGCAGCAGAAGGGCGAGAAGGTCCGCTTCGTCACGGGCGATAACGTGCTCGAGCTCACGG
AGAACGACATCCTCGGCAGCAACAAGAGCGAGCAATAGACGGCGATGCTCGTCTGAATAGAGGATTTGTCTACTACACAACAAGCGCTCATGTCAATCTG
TCATTTGAGTTATGTGGTTCCTTTCGTACTTGTTCAGCTTGCTATAATCTAGCACCGTGCTGTTCTAGCTACTGCGTACGCTATGGTGGCTTAGTTTGCT
AGTCTTCAGTCAGATGCTGAAGCCACACCCGCCGACCCTCGCCGCGGAACATGACCTGCTCGTGCGTGTTCACCTGCACGGAAGGGTTCGCAGATGCCAG
CTTCGTGGTCTTGGCCAGACGCGTCGAGTCGATCGTGCTTGTTTCTATATGGTGCTTACGCTTCTTGCTCTGGTTCTTGTGCCGCACCATGTGCTCCGAC
AAACTCTCCTCTTTTCCGTACACGCGTGAACACACGGGACACTTAAACCACTGCTTGCCGTTCTTCATCTCGATGATAGGTTGGAGCTGGTCCGGCAGCA
CCACAGGCGCCAAATTGGTGGTATTCAAGGACTTCTCCTTGTCCTCGTCGGGCTTACCAGCGCACTTGTGAAACTGCATACCGCGACGTGCGTTAAACTT
CATATCACACAGCGGGCACGTAAACGGGTGCAGCTTCTTCTCGTCGACGGCCTTGTTAGGCAGCAAAGCCAAGTTGGCAATGCCCGCCTGCTTGTTTTGG
CCGATACGGATTCCATTTTGTGCCGAGTACATTTCCTTGCTTGTCTCCATGTAGGCTGCAATCACGCAACCTGCCACCATGGCATCGAACTGGTGCACGT
GTTCACGGACGTCACGGAATTCGGCGAACATTTTCTTGGCGCGACTGCCCACGATTTCGTGCAGATCCAAGTTACTGATCGTGTGGTCAATAAGACGGCA
CGCTTTTTGTTTCATCTACAACGACGCCGTCCACGTGAGTAGGCTTTGAGCGTAATGGTTTCCAGTCACGAGCACGGCCAACATACCTGGTCCTTGTAAC
CAATACGCGTCCTTCGTTCGTCCTTACCCATCTGACTCAGGTTCATCTCAACGAACTCGGCAGCTCGTCTCAAGTTGCCCGCCATCTCGCCGTCCTAGAC
CACATCAAACCAGCAACGGATGAATACCTGCACTTTTCTCTTCTTCCGCAGCCTCCGGGTTACCTGCGAGATCAGCGTCCGCAAGTTGTGTCCCGTCGAG
AAGAGCTTGTTCGGCGCAGGTCCGTGGTGCGACTTGTCCTCTTCTCCTTCGAACTTACGGTACGCACTTCCTTCGTGCACAATGTGGTCTTGCACCACCG
TGCCGCATCCATTTCCATCCACGCCGTTGCAGATCGTGTCGCCACGCGCGTAGTCCGTGATGAAGTTGTTCTGCTCTGTGTTGCCGCACGTCTCGCAGCG
GAACCGGGGCGCTACAGACCACGACAATCAAATAAAACACGCCAAATCGTTACTCCGCCGTACACACAGCCTCAATACCAGTATATGCACCACCGCATCC
CGGCCATTACCTGTCTTCTGCTCGGCGTCCAGCTCCGAGAACTCGTCGGCGTCCGACTTGCCCGCCTGCTTCATCTTGCGGATCAGCAGCATCACGTCGT
TCACCTTGAGCTCGGGCACCAGCAGGTTCACGATGCGCTCCTCCATGGGCAGCGCCGGTTCGTCAGCTTGTCTAGCGGCCTTGGCGGCGGCTGCACGGGC
CGCCGCCTCCCTCTTGGCCGCTTTCTTGGCCGCCTCCGCCTTCCTCTTCTTGTCCACCTGCGGAATCCCATCGAAAACACCGTTAAACCCTGCATTTTTA
CGCTAATTTCCAGCGCAATGTGCAGCTGCGGACCATGACGAGCGGCTCATCGTCCAGCGAGGGGCGACCGCCTGCGTCTGCGGCCGCGCTGGCCTCCGCC
TCGGCGGCTCCGAAGCCTGCGAAGACGTCCTCGGCCGCGCCGTTGTTCAGCGCCGCGAAGAAGTCGTCGGCGCCGGCGTCGAGGTCCATGGCTGGCAAAG
GTTGGTGCTCTGGGTTACACGCGGCGCAGGGGCCAGGGGAGGGCAGGGAGGGCGCGGGAGGACGAGTGCGAGGCCGCTCTTCTCCCCCACCTCTTCCATA
CAAAGCCAATTGGCGAGTGCGCCAGGAGCTGCACAGTACAGTAACGTGACATGTACTGTAACGCGTCAATTTAAGTACCAGGTTGTTGTATTAGAGTTTG
GTTGCTGCTTTAGAGACCCTGCAGAAGATGGTCACCAAGTTTGAGAGGCGATCTGTGCGACGTGTAGCCATGTCTGCGCGCGGTAGCTGGCTCGGCACAC
TGGGCAGAGCGAGACCTCGTAGATGTTGAAGTCCTCGAACGCGGACAGGCATTGCGAGTGGAAGGCGTGTGAGCAGCTTAGAAGTGAGACGCCGGTCATT
GATGAACTGCAAGGAATTGGTCAGAGAGATGAAAGGTGAGCCGGAGGGTGGGTGCAAATTCCACGAACGTATCCTACCTGAACGAGTTGATGCAGATGGC
GCATTCGCTCTCGTCTCGAGCTTTGGCCTGCAGGCGAGATCGAGCAACACACACATATTTAGTAGTAAAACAACACTGTATGGATCAGTGCTGGCTACGA
ACTTTGCTGAAGATGGCCAGCCAGTCGTCGCCATCAAACGACGATCCTGTACCCGGATCTACACGTCGGTTGTTGCGTCGGCAAATATTAGTAAAGCGAA
AGCGATGACTGCAAAAGACTGACATACCAGTGTCGGTCTCGGGGACGTGGTCCTGGAACACTCGGCGACTCATGCTTAGCGATTTGTCGAACTCGGCCAG
CAATGCGTCGATGGAGTCGTCGCGTTTGCTCATTGCAGTCACCAACCGATCCGCTGTTTTGCCGACTCTGGCAAAGGATACAAACAGACGCATGTTAGCC
TTTCCATTTTGTTTAGTGAGGGTCATGCTCATGCTGTACCTGCTTGCAAAAAATCGCCGGCGACGAACGGGGTCTCCTTTGCCTGAACTATAAAACTAGG
ACCCAAGTTCCAGGTTGGCAATGAATGCGCAGGCAAAACATGTAGCGATATTTTAGGTACCTTTTGCCACAAGCTAGCAACTTGTCGTCTTGCTGAAAAC
CCACGAAACACAGCCTGCGAAGATTGTCTTTAGTTATCAGATAAGTAAGACGAGCAGCGTCAATAACATCCAAGCACGAACCTGAATTCGTTTGGCGCTA
TACTCACGATGAAATGCTGATGCCATTGTTGTAGCACGCTTTTGGTAATCTTGCTTTCGGCACAACGGGCATACGCGCTGGTTCGTGCGCAGGAATCTAA
AATGACATGAATAAATTATAGATTCAACTACAGAGTCCGAAAACACAAACAAGAGAGCTAGAACGCCCACCGTTCGAAACTTGTGATGCAGGCGAGATGG
AACATGTGTGAGCAGCTCAATATTACTTGCTCTCTAACGCCGAACGGTTCGCGGCAGATAGAGCATGGGTGTTGCGTATCTCCTCGTGCTTCAGCCTGTT
GTTCACAGTGCTCCCATTCGTCTCTGGTCAGTTTTGGTGGTGGACGCGTGACCTGCATCACGGCAAACCAAGCTCAGAAAAAGAAGCAAAACCACTCCTT
CGCTACAGATTTGAACGTACCAGGCCTCGCTTTTGGGCGAGTGTCAATCGAGGACGAAGTTGTTGACTGCGTTGAGTTCCGCAAGCGGAGCAGCGGTCAG
AATCACGCCCGCAGGTGCTTGAATGAGGCCGCTCGTCGTTCTCAAAAGTGCAGGAGTCACAGACCCACACACAGCGGTACTCCGAGTTTGATGCGCTCCG
AGTGGTCAATTTTTCACGAGTGTCAACCTACAAGCATATGCAGACCGCGGTGTGAGCGAGCTCCGTGCGAGGCATAGTAGGTTTAATAACCTACGACCGG
TTTACGGGGCTGTCGTGGGGGAAGGTGCAGGTCTAAGGTGATGGATCGTGCTAAGTGATCCTAAGGTCATTTTTGCGTTAGGAAGTTACCAAGCCATGCA
GATGTAATAAAGCAGAAGTTCTACCTGTAGCGCCGCCGCATTGATGATCGTGGACTTGTCCAGCTTGGCTGCAAAGAGGACACCCCGAGTCAAATTCAGT
CCTCTGTGTCAAATCGGGCTCTAGATCCACCTTCGTTTCGTCGCCTAGCACGGTTCATTGTCAGCGCAAACTCGCGACCTGCGCCAGCTATCGGAGGAGT
TACCTCAGCAAAACCCGATGCACAGGGCTAGGAATGCCGTTTCAGCCCAACAAATAACGCCGCCAAAGGGCGGTCGCACTGCTGCCCATTCGACATAACG
GCCGCTGCCATTCCTCCAGGTCCTCGCCCGCCTCCGTCCTCTTTACCGAGAAAGTTTACGCATGGAGCCGAAGCACTTTGACCACGACGAGGAGCTCGGG
TGCAAGATCAGCAACGTGAAGCTGAGCGAGAAGTCGCGTCTGAAGGACGCCGAGGTGAAGCCGGTCAAGGACGACGAGTCCCGAGCGGCCCAGGCCAAGT
TGGATCTGGAGGTTGAGCGTGAATGGAAGCAGCTCCACGATGCCGGCGCTGGCAAAATTGAGGTCGCCAACAGTTCGTGGGCCAAGATAGTCTGCAAGGG
CCTTACCATGTAAGACTGTAATTCCTGCATTCCAGTGAGAAGATCGACTATGAAGGCTGACTTTTCATTTCATGTGGTGACAGTAACCACATGAATATGC
GCTGCGCCGACACGGGGCGACTGATGTGGCAGTCGGATGAATGGTAAGCGCACCGTGCTAGTGCCGTGCTAGTGGTATGTTCCGCCAAGACTAACGGAAG
TGGTGACAGGGGAGAGGATATCTACCGTGTCGAGCAAAAAGGTACTTCGATTGGAAAGTGTATTATCCATCAGCGCCCTAATTCTTCTCATTGTGCTTTC
AGCACGTCTTCCTGTGGACATTCTGAAGTGCTCAGCTGTGTCGCGCGAGATCAATTTCAGCTCAGCTGAAGAGATCTCGCAGTTTCGACTGGAGCAGCGT
GTTTTTCTCGACGGAAGCTGCATTGAAGGTGCGTTTTTAGGTCGCGTTTGAAAAACGTGACATCACCAAAACCAATTGGAACTTACCGCTACGTTTGCTG
GATGACAGAATGGCTTTTCAACTTCGGCTACGTGATTCCTGGATCAACGAACACCTGGCAGCAGACTATCGAATCAGCGGGTCCTGAGAACATGCTGGAC
CCGGAGATAATGAGGTTTGTTCAATTGGTTTGCTTTAGTACGCAACGCTGATCGCTCATTGCTCTATGCCTCACAGTGGCAAACTCACGATCGAGACGGC
ATTCTATGACGGCCAACTGCCAATTGCCAAGACCGTCTACAGAATATATTATGTCTGACAGCAGTGCAGCAAATACTCGCAGGCGAGTCTGCTGCTCTCC
AGATGGTGGTGAAACACTACAGAACTTAGGCTCTTGAACAATTCACGCTGAAGACAAATGCATGTACTGAAGACGACGCCGTTCTTTCATATCGTAGCAA
CCGGCGCTCTATAGTTCTAGGCGCTTGCCCTCTTCTCTTGCCTCACTTGCGTTGATCTCGTCGATGGGATCAGGGTAGCAAGGCAACTCGGATTTGAATT
GATGCAGATCACGGATCCGAATAGGCCGCGGAAGCGCGCGCAGCTCTGCCAACTCCTCTTTTGTTGCGTTCTTGCGCTTGTCGTGCGCAATCTTCTCGGC
CATGTTACTGCGGCCGATCACGTGCACGGCCAACTTCTTGGGGCTCTGAAGAATCCATTCACGGTAGAGCTGCGCCATCTCGCTCTTCGTCACCGTCTCC
AACTCCTTCGCAAGTTGGTCGTCCATGTCGAATACCAGGCGTCGCGACGTAATCTCATACCAGTAGTGGTGTGTCGTCTCGAGGAGGTTGTGATCGGGCT
CAAGCTTTAGCAGGATCTGTGCTTGAACATGGTCATGGAAATGCTCGTCCGCCATCATTTCGATGGCTTCCTCAAAATCAACCATAAAGCGATCCACACA
TGCAGAAATGTACTCAGCAGCGAACAACGACGACTGAACCATCACACCGAATCCCAAAATGCCGTTCGTAACCCGCACAGTACAAGCAACATCGTAGCCC
AACTCTTGCTTCGTGCGAAGCGTGTCAAACAACGGTTCCTCCATCAACTGGTGCAGCAAGTCAGCATATGCCAAATGACGTAGCGTGAGCGGTCCAATTT
GGTAGTAGAGCTCCACCTGTGTATTAGTCTCGGACCTGTTCTCGCTGCGTTCCTTCAACAGGAATCCTACAGGAGTTTCCGGAATAGCGGTGATGTGACG
ACGCGGAAAATTGCGGAGGTTAAGTGGGGCAGCTATTCGTTGCAGCTGAGTTTCGACTTTGGCAATCATTCCAATCGCCACAGCATGGGCAATGTTCCCA
TGCGCGAAGCTCGCCAGCCACGCCTTCCCTGCCCACAACTGGTTTGAAACATACCCCTGAAGTGATTCAACGGTGGCGACTTCCATAGAATCTAAGCACT
CCTCCAACGGGAAAGCGCGCTGTTCCAGAAGCTGCAGTCGCAAGTATTTTGCTTTCTGAGACACCTTCGTAATACCGTTCTTGGATTCACGCATCAACTC
CTCTCGCATCACCTCGAAGCGGGCTTCGTTGATCTTCGTTCCGAAAACAGCTGCAACCACCACTTCGACAAGCAGATGCAATTTGTCGTTAAACCCACCA
AAAATGAGTTCGAGACCAGACTCCTTTACGTGGAGCGAGTACATGAGCTCAGCTACGTTGGCGTGATAAGCGTACTCGTTTAGAGCATCTTGGACCAGCT
TAACGTACAGCTGTGTATGGGCCCAATTGTCCACATTCGCCACAACGCTCGGCAAGTGTATCAAAAGCGCAACGTGGGCACGAGGTGTCGCAAACGCACG
GTCCGGCTTGTACCAAAGCTTGCCAAATGACGTCTTTTCACAGACGAGGTCATCCACACCTGTCGTGTCCACGAGAGAAAAGTCTCGCGGAATAAACTGG
TTCGGTCGAGGCAAATGAAGCTTGGAGTTGATCCCTGCCGTTTTCCAGCGCTTAATCGTGGCGGTAGAAATATCCTCCTTCGAATATTTTACTCCAAACC
ACTCTTCCTCGACGACCTAAATATCCGACACCAGTTAGACTTGTGGCCAGCAAAATTCAAACTATATCATTCCATACCTGGGCCTCAAATTCTGGCGTGT
CTGCAAATGTTTGTGAAACGATTGAGACACAAACCGTCTCGGCGGTCAAATGGCGTAGTACCTCTTCCGCAAGCTCTTTCTTGAAGCTACCCTTGAAAAG
GTCGTAGCGCAACAAATCTTCTGGCGCAACCTTGAACATCGACTGTAGCAGTAATCGGTTGAGTTAGTGAAATGTATTTGAGTATCAGTATGATTGATGC
AAACAAGGAAGAGCGAACCTGCATGATTTCACCAAGCTCCTCACAACGCTCTACGGCGCTGTCTTCTTCCTGGAAACGAAACGAAATGTCGGCCAGCGCT
GCCAGCTCGTCGAATATCCACGCTGGACAACCGTTTACTCGTAGCATATGCAAGTACTCAAAAACTGCGTGCGCAATTTCCTCCAAGTGGGAAATTCCCT
CCAGTGTGAGCTTCATGGTCACATCAAACTTTGCAGCATAGGTTCCACAGTCGTATCCATCCGTGTCTGTCACCCCTGCTGTAACAGCAGAAATCCATCC
CCGCTCCTTCAGCTGTGATAGATGGACGACGTTCACAGGGTAAGTTAATGAGCACATGCGTCCTCTTCTGTTTGGTTCGGTCTAACAACGTACATGTGAC
AGCACTGAGCCCTCGCTTTCATGGCCCAGCAGACTAGCAATGTAATCTGCAGGCTTCTGGTGGTGTTGACCAAGAACCGGTGGGATCATCCAGTCGAGGT
GGAGCGTGTGAATATCCCGGACGGGCACAATCTTGCAGAGGAACGGGGAGCCTGCGCCATGGGCCCCAAACGGGGGGCCGGCCGCCGCAAACGAAGGCAC
TTTCACCTGCTTGTTCGGGATCGCGCTGAACGACGTTGTGACCCACTGCTCCATTTCGTCCAGCGTGTTCTCCCCACACACGACGAGCTTCATGATGTTG
GCCGAGTAGTACTTCTCGTAGAACTCGACAATCTGCTCGCGCACATCTACGCCCGCCTTCTCGGGCACCTCCTGCAGACTCTTCTTGTTTCCCCAACTGA
AGCGATGGTACGGGTGACTCGCAGGCGACACGTCGCATAGCACTTGCTGcaaccaaccaaccaaccaacATCACATATCATCAGTACAGTACCCTCTACT
CTACCCTCCTTCTCCCCACCTCACCTGTGAACGGATCCTGTCGTTCTGCGTGGCCTGACTGAACTCAGACTCGATGGCCGACAGCTCCCTCTCCATGGCC
TCCGCCTTGCACAGCGGGGAGATGAAGAAGTGCGCGAACATGTCCAGCGCCGGCTCCAGATGCGCCGGGCCCACCTCGAACGTGTAGCTGGTGACCTCGT
TGTCCGTGGCACCGTTGCTGTAGCCCCCGTGGGCGCTCAAAAAGGACTCGAACTCGTTCTCGTCCGGGTACTTGGCGCTGCCCATGAACAGCATGTGCTC
CAGGTAGTGCGCCAGCCCCGGCAGCGCCTCGGGCTCGGCGAAGCTGCCGACGCCCACCGTAAGGCAGGCGCCGGCGCGGCGGCTGGGCGcgccgtcgcgc
tcctcctcgctgtcgtcgaagctgctgccgtcgtcgtcctcgctgccgctgaagtcgctgccgtcgccgctgaagctctggtcgtcgtcgtcgtcCTGCT
GGCTCAGCTGGCTCTCGCTCTCGCGCGCCACGGCGGCGGCCACGTGCGGCACCTCGGCCGTGGAGATGAGCAGCGCCTGCAGCGCGTTGGGCAGCGTCAG
CAGTCGGTACTTCTTCTGGTCGTTGGGCGACTTGGACCGCTCCACGGGGTCCCGCGTCGCCGCCATCGCTGCTCGGAATCGCAAATGACGATCCCCGAGA
GTGTCCATTTTATAAGATCCATTTGTGTGACTATACTTCGATCAAGTGCCAGAAAAGAGCTCATTTTGAGGTGGATGTGTTGATAAGCCCATTTTATAGA
CCCTTTTTCGACGCCCCTCTCCAGCCACAGACCGAAAGCGCAACACAGAGGAGCGACACCATGAAGCTCGGCCGCGGCATCAACGTGGAGCACATCAAGC
GCATGACGCTGCGCACCGTGCGCGAGAGAACGGAGGGCCAGCCCGAGACGCTCGCCTTCCTGGACGCGCTGGAGCGCAACGACTTCGACGAGACGAAGTG
CAAGCGCGAGGCCCGCCACATGATGCTCGTGCTCGAGGCCAAGGTGCGGATGGGCGACGGGGCTGTGTAGATGGATGGGTGCAGTACTGACGACCTGGTT
GTGTGTTTGCTCCCGCGCAGAGGAAGCGCCGCGCTGCCGAGCACCGCTCCACGCTCAACTTCCACGTGATCCGCATGATGAAGGGCCACCACGACCCGCG
CCGCTAAGGAGGCGGATAGGAAGGAGGCGGCGCAGCGCGAAGGGGACGACGTGCCTGCTGCCAGTTATGTAGAAGGATTGCCGGCAGCTCGCAGCCTTGC
CCTCCGCAGCACCGCTGCGGGAGGCGTTATCTAACCGATAAACTTTCGCTGGCGTCGCTCTGTCCGGCGTCACGCGCCGTTGTGCATGTGTTGACGGTGT
CTTGCTTGGCATTGAGAATCAGCTAGGGTTGTACAGGGACACATGCT