Description :
From Genome Similarity Track
Location :
Scaffold_124:15041- 17592
Transcript NameFunction/comments
Hyaar_Emoy2810354hypothetical protein

Sequence
2551 bases(100 bases per row)
AGGCGCAGAAACTAACATACTCGCCACGAGTCAATACCAGTAACAGTCTATGTGATACTGGCATTGACCAAGAACGAGGTGTACGCTACCAATCTGACGT
ACCTGTGTCCCAGAACAGGGATTGAAAAGACACCTTAACGGGTGATTAGTCGAGAAAGGTGTGGAAGATAGGTCGTTACATGAACAGGGGCGGTTCGACT
CGTCCATAGCCTTTTACTCCAAGCAAAAGAGACGAGCTTTGAGTAATGCGTGTGAAAGTGGCCGAGCTAGCCTCCACCGAATCGATTTTTCTTCGTCGAT
GAAGCGCCCGATGGGTACATTCATCAGTGAGTGTTTGCGTCTATTTCAAAACCACCATCTGTTCTGAAATCGCCACTCGTGCGGAGTTGGTACATATGTA
TTAACTATGTCTTCCTGCTGGGTTGATCTGTCAGTTCAAATACCACTACATGTCCCCAATGTTCGGTCGCTGAGCCTAGCAATTGCAAGAGGGTCGCTCA
CCCACGCACCATCCTTCGATTCTGGGAGACCTGCAGTTCTTGCCCAAGAGCGTGGTGTCGTCATTCTCCGCCAAGATCAAACCCTTCGGTTGGTCCGCCG
AACCGTCTTTGTATCTACTAATGTCGTATTCATAATCATCATATGATTAATTGCACGTAGCGCCTCACATCCATCTTTGCTGCTGTCGATTCTATAATGA
TGTTTAAACTTGGATATTGTTTTGAAGCAAATGAAGCGGCGCGAGCTGCGATCAATGATAAGTGCCACTTAGGTGAACCATTCCAGTGTTTAAAGTGTAC
ACTTGTCGCCACCTTCCCAGCCTGACTGTCGTAGCTCCTATTCTGGTTTTACAGCAGTAGACCAAGAAACTCAAGCATTCGTCCTGGGAGTGTACGAGTC
CTATGTTACCCCAGTTTGAATCGGATCTGAGGACGACAAATGCATTATATAAACGTGGTGTACAGGTAAAGAATACATGCATTGAACAGCTAGTCCACTA
CACATATGCAAGCAAACATACAAATGCTAACACCTTGTCGAGAAGGTTATTATGAATTTAACGTACTTGCCAGGGAAAATCAAGCTATAAAGAACTACTC
TGTCGCCTTGGAGTTCTCATTAGCCGACGAATCCTACAATGGTCCCTGCATGGGGCTGTCGGCTTCCTTAGCGATGGGATCGCTTTTGTCCAACACCATC
AAGTCCTTACTTTTGGCGGGACCCGTCGTTTTAATATCACTAGCCCCGCCGAGTGAGCTATTCGAGCCGTCGTCGAAGAGGCTGAGAAGTAGGGCTTCTT
CACCACCCGACTTGGTAGACTTAGACGCCTTCGTCGCCTTGTCACCACCCTTCGTTGCGGCAGGGTCCACTTCCTCGTCCTCGTCCTCGTCCTCATCCTC
GTCTCCCTCAAGTGAATCTCCCTTGGTGGCAACACCCTTCGCACCATGAGGGTCCACTTCATCATCCTCGTCCTCCTCAAGTGGATCTCCCTTGGTGGCA
ACATCCCTCGTGCCGCCTAGTAAGCCGTTCGATCCATCGTCGAAGAGACTGTAAAGCGGGGCTTCTTCACCGCCCGACTTGGTAGCCTTAGACGCCTTCG
TCGCCTTGTCACCACCCTTCGTTGCGGCAGGGTCCACTTCCTCGTCCTCGTCTCCCTCAAGTGAATCTCCCTTGGTGGCAACACCCTTCGCACCATGAGG
GTCCACTTCATCATCCTCGTCCTCCTCAAGTGGATCTCCCTTGGTGGCAACACCCTTCGCACCATGAGGGTCCACTTCATCATCCTCGTCCTCCTCAAGT
GGATCTCCCTTGGTGGCAACATCCTTCGTGCCGCCTAGTAAGCCGTTCGATCCATCGTCGAAGAGACTGTAAAGCGGGGCTTCTTCACCGCCCGACTTGG
TAGACTTAGACGCCTTCGTCGCCTTCACACCGGTAGATTTCTCGTCCTCATCCTCGTCCTCATCCTCGCCCTCATCCTCGTCCTCCTCGAATGGATTTCC
CTTGGTGGCAACACCCTTCGCACCATGAGGGTCCTCGCTTTTTAAGTCATCTGCGAAGAGCCACGAAATGTCACCCTTGCTGCCTGCACTTTCCTCGTTA
AAAGCGGCAAAGTTCTTGAAATCATCCGGGGTCCCGCCGCCGTGGTCCCCGCTTCCAGACGTATCAGGGAAGAGCAACAAGTCAAACATGTCGTCTCTCA
AGCCCTTTCCAAAGATAGGACTGCTCTTAGCACCACCCTTGCCAACGGTGAGATCTTCTTCATCAGGATCATCTTCCTCATCGAGCCACGAGAGGTCACC
AAAGCCTGACGTAGACGAGTCTTTGATAGCATCAATGATGTCCATCAGGTCCACCTGGTTGCTTCCACTGCCAATAAGGTCCAGGATGTTAACCTTCATA
TCGTCTCCGGCGCCCTTACCGCCCACGAGGCCACTGATGTCCGCTGTCAGATCATCTTCATCATCCTCGGGTTCTTCGTTTGCTTTGGCGCCCACAGTGC
TCGTCAACTTGCCCTTGCTCATAGCTTCTTCCTTCTCCGTTGAACGAAGGT