Description :
From Genome Similarity Track
Location :
Scaffold_30:1504- 3435
Sequence
1931 bases(100 bases per row)
catgtatctcgatggggaggaaatcctctccaacgaatacgacaacgaacctcttgagggttcgttctcttatgagccacgatccgctcaactatccagc
ggattgacccagtcgcgtctcgcaacggcggcggagggggcggaaacactccctccgtatggtcagcgctatggccatggcgatcgtgccctgcacgatc
gtgttgcggcgctcgagcagcctcagagcgccgagatggctgctctgaagcaggaggttcgagtcctccgtgctgatgctgcgcaggctgcgcagactgc
atcgaacatctcgtccggtctcgggacgagattgaacgctctgatcgctcgcgtgaacgatctcgagaaggccttccaggcctctcaggcgagtcatcac
ccgtagatgactcgtgctgcacgtacggcttcaaccgcccgacgtagaacgtcggatggagtctcatgctggacggtatgtccagccggtacgcgttacc
atgccgttcaaggactttgaacggcccgatgaaccttggagcaagcttacttgctccaaaatcagacactgcatgtttaggcaggttttgagtagctaac
aaaaccaatgaaccctttttgaattcattaatgttgcccctaccaacattgtctgcgttcagcttctgtcgatcgacagaagctgcgatagcatcttgca
caaaccgtattacggcttgtcttcgctggacaaagtctagcgcattcgagctgaaccctttcagctcgtcgccttcatccgcagcaggccctgcctgctc
gctatcatcccctatgtctgtgcccggcacagacatctcgcgctcgttcctgctcgaacgagacgcagctcgcgtcaccgcagctgatagtacgtcatca
gctgtcctctgcggttgttcagacgcaaccgtagatcctcccccacttaaggaggaagctaccccgccgagcatgctcggcaaacgtggatgccacatgg
cattcacgtagaacggtgtatgccctgtcgaggcatgtaccgagttgttgatggcaaactctgccatcggtaaacactcgctccaatgcgggaacgagtg
tgcgtagctcttcagcgcgtcaaccagtacgcggttgacgcgttcagtctggtcgtccgtctgcggatgatccgcagtcgacattgacaactgtgaacca
agaagtgtaaacacttcttgccagaaccgcgctgtgaagcgtggatcacggtccgacacaatgtcgagcggcatgccatggtgtttgaacaccatgtcaa
caaacagtcgcgcagtctgcgcggctgtaactgtagccgggacggcagcaagatggaccatcttgctgaatcggtccacaaagacaacgatgcctgtcct
ccgcttgttgtcgggcggaagaccgaagacaaagtccatggacatggactgccaacactccgacagagtcggaagtgattgaagaggagcctgcgtaaac
ggcgcaggcttcacgcgctggcaaacctcgcaagcacgaacgtacttgcgtacccacttgtactggtggtgccagtagaagtcacgcgtgagaagagtgt
atgtcttctcacgacccagatgccctgccgtaggggcatcgtggtactcgaacatgacccgcagccgcagatcatgatcattcggaacgacaatgcgatc
cgcattgtcgtctactgcactgtacagcagtagcccttcgtgtacacgatagcggtgtacacgagctcgaaggtgaggagttagcttccgacgtgcctcg
tcggaaggtgctgcgaggaactccagcagctccttcgcgtctgcatcccttgcatacgcgtccttcacgtcgtcaatcaacgttgacgacggcacacttg
tcctcacgacgccaacactgttggcgtcgac