Description :
From Genome Similarity Track
Location :
Scaffold_33:150356- 151387
Sequence
1031 bases(100 bases per row)
CAAGATCGCGTCCCTCAGCATCTGTTTGTAGAAGACCAAAGCCAATGGAAAAATCCGAAGCTTCACAGACGACACTGAAGGGCCGATCAGAACCTGGCAA
GGTCAAAATCGGGGCATGTAGGAGACTTTCCTTAACTACTTGAAAAGCATCATGTTCGGTGTTACCCCAACACCAATCCACATCTTTCTTAAGGAGATTG
GATAATGGCCGAGCCGTATCTGTGTAATTCGCACTATACTTATGCAAGTAGTTGGCATGGCCAAGCCACTTACCTAGATCTTTTTGGTTCTGTGGGACTG
GCCAATCCACCATGGCCTTCACCTTTGCGGGATCCGCCCGAAGGTCTCGCTTCCCAATAAAGCATCCCATAAATGGTATCTCGTCCTCACCAAAGATACA
TTTCAATGCATTATCATGCATCTTTTTTGTGCGCATGCACTCGAGCACAGCTCGTAAATGGTCGATATGGTTATCCACGTCCGACCGACCCTGTTTTCCG
CTCGACTATGGACAAATTATGTCATCAAAATATGTTTGTGCATAATCACGGTGAGGGCGGAACAGTTGCGTCACCAGAAGATTAAACGTAGCCGGGGCAT
TAGAAAGCCCTTGGGCATAACCAGACACCCCCAAAGCATACCACTTGTAATACCAACCGCTGTAAGTGGGATATCACATGCTCGCATGAGCAGTTGCGAA
AACCATCAACCAGGTCGAGTGCACTATACATTGTACATCCTTCCATGTTGTTCTGAAGAACATCCTTTCTAGGAGTGGGTGTTTGTGCTAGTATAGTTGC
CGCATTAAACTTATTATAAGCATACACAATACGCCACTTACCATTAGGCTTTTTGACACAAAATCTCGGTGTGAAATGAAAAGAATTACTCTCATGTACC
ATTCCAGCCGCGTAATTGGCACTGAAAAACTCGTTAATGACGTTACGTTGTTCCTTTGGCAAAGGCCACTACCGTGTAACGCAGTATTTGGTTCCTGGAA
CCAAGTCAATTTCATGACGTACGCCCCTATC