Description :
From Genome Similarity Track
Location :
Scaffold_93:150266- 153304
Sequence
3038 bases(100 bases per row)
CTTATGCTGATCTACATATCGCTTTAAACGACCCACGTAAAATACAGGAGGTGTTTTCATGTATTGTGGAAGAGAGAGCCTATAATTTAGGTCTCCGATT
TCCTCTACCACAGTGAAAGGCCCGATAAATCGTGGCAATAGTTTGGTAGTACCACCGCGTAGTACTGAAATTGCATGTTTAGGTAGATTTTTAGTACCTT
GTCTCCTACTCTAAAGTGTTCATGATTTTTGCGACCAATTTGGTCTGCATATTGTTTTTGCTTGTCCTGTGCGCTTACCATAACGCCACGGATCTTACGT
GTGATGGATAATCGCTCATCCACAAAGTGTTGAGCTTCTCGAATGCGCTTTGTATCCAGCTCGTCAATGACACCACCAAGAGGTCGGCCATGGGTAGTTG
CTGCTAATGATGACCTATCGTCATTACTTTGGAGCACAGACAACGTGTGTCGTGACTCCGACTTGACACTCTCTTGTTTCGTGACCACTGCGACGCTGGC
AGGGTCACTAGAGCAAGTTTCTTCCATTACATTGGCGGAGCCATTACGCTCTTCCGCATTTACTCCGAGCGTAGTGAAGAGCCCTACCCCACTAAGACTC
GGGCTGCGCACAAACAAGACTGGCGTCCGAGGATGGCGCAGTACGTTAACATAAAATGGTGTTTTACCCGTACTGACGTAAACACTGTTGTTAATAGCAA
ACTCCACGAATGGGAAATGTTTGCTCCATTCTTCTGGAGGTTCTCTTGTGCATAATACATCCGCCACAACACGATTGGCCCTTTCGGTCTGGCCATCGAT
TTGGGGATGTCGGCGATAGACATGTGGAGCTGGATACCAAGCAACTCAAATATATCGCGCCAAAATCTTGACGTAAAACGTGGATCCCGGTCCGAAACTA
TGGACTCGGGCATCCCGTGTAGCCGATAAACGTGATCCAGAAACAAGAAAGCTGCCTCCTTGCCTGAGATCTTGATGCTACACGGTGCTAAATGCACCAT
TTTGATCAGTCTGTCAACAAAGAGGACGAGACCAGTCCTGCGTTTATGGCCAGGCGGCATGCCAAACATGAAGTCCAAACTGACCGACTTCCAACAATCA
GTTGGTATCGGTAGTGGCATTAGTGTCTCACTACTAGAAGGTGCAGGCTTTACGCGCTGCAACTCTTCGCATTATCGATTAAAAAATAATTGGTTACTCA
CATATATAGGTGTGGCCACCAAAATTCATCTGACACTCGTACGAATGTCTTCTCACGGCCCAGACGATGGTGCATCATGGAGCTCATAGAGAATATTCTG
TTTGAGATCTGTGTCATATGGGACATAGATTCTCAATGGATCACAAGGTGATAGTTGATGCCATAACAGGCCATCACTATAACTAAAGCGCTTAAGCTTC
GCCTTGAGGTGCGACGGAAGATTAACTTTTTGTCCACCAAAGTCGTCTATAAGCAGACGACAATGTTCTTCCTGCCTGTAGCTCTCCTTTATATTAGAGG
CCAGAATGTTTTGCACATGGTCAACCCGTAGGGCTGCCAGTGTTGACGACTCACTTCGTGCTTTAGCACGAGACACGTCTTCAAGGTGTCGTTCTCGAAG
TCTGGTCTGCGCGATAACGCTTCAGCCAAGACATTCGACTTACCCGGCTTGTATTCGACTCGAAAATTAAATTCTGAGAAGAATTTGATCCACCTCGCCA
TCCTAGGTGATAGGTGCGGTGAGTTTATCGCGGTCCGCAATGATGCGTGATCCGTGTAAACTACAAAAGGTTCGGTGCCCAATAGGTGCACTCGAAACTT
AACAAGAGCATACATTATATAAAGTAGCTCCTTGTCGTGCACGGGGTAATTCAGCTCTGCGGCTTTTGAAAGTCGGGACTGATACGAGATGACACGGTCA
ATACCGTCGTCATCCGTTTGCATAAGTGCACCACCGATAGAGAAATTACTCACATCGCAGACAACACGATAGAGTTTATCCGCGTCTGGAAAAGCCAAGA
CCGGACCTCTACAAGTAATTGCTTCACTAAAGTGAAAGAATCTACTTGAGCCTCACACCAATTCCACTTTGCGTCCTTTTTCAGGAAGTCAGACATTGGT
TCGGTTCGCTCTGCATAATTCTTGCTATATTTGTGCAAGTAATTAGCAAGCCCAAGAAATTGACGCAGATCCTTCACATTTCGTGGGACTGGCCATTTAT
TAATAGCTTTAACCTTCTCTGGGTCTGCTCTAACACCGTGTTTACCCACGATCCAGCCCAGTACAGGTATTTCGGGGACCCCTATGACGCACTTTTGAAA
GTTGATGTACAATTGGGCGTCACCCAGAGTCTGCAACACAACGTCCTAATGACGTTTGTGCGATTCTATCTCACTCAATCCATCCTCGGGCCCTACTATG
AACGAACACATCGTCAAAGTAATGAGGAGCTTAGGCACGGTGTGGGCGCATCACATGAGCGACCACCCGGCTGAATGTCGCTGGTGCGTTTTTTAACCCT
TGCGGCATCACTAGCCACCCCCACAGCATACCGCTTGAGGTACTAACTGCCGTCTTAGCTACATCGGTCTCATTCATGAGTACCTGATAGTAGCCATCCT
TTAAATCCAACGCGGAAAATTTAGTTAACTTCCCCATTAAGTTAAATAGGACATCTTTACGCGGGATCAGTGTCTGCGCTGGGATGGTGTCCGTGTTCAA
CTTATTGTAAGCATGAACTACGCGCCAACCACCTGTTGCCTTACGCACACAAAAGGTTGAACTGTAGTGAGGCGATTTTCGCTCACGTACATGTCCCGTA
TTGGCCCTTTTGTCGAAGAACTGGTCGATTTAATCGACCTGTTCCCTTGGCAAAGACTACTGCCTGGTCACACAATACTTGGTGCCAGGTTCCAAGTCAA
TCTCGTGCCGGATACCCCTATCGGCTGGTAGGCGGCTCGGCACTTCTGTAGGAAAGACACCACGGTGCTTCCACAGAACTTCGTGAAACAGACTGTTTTT
AAGGCGTCCCAGCTTTGATCATCGAACCTTTTTGTCTT