Description :
From Genome Similarity Track
Location :
Scaffold_47:150243- 154341
Transcript NameFunction/comments
Physo_136640NADP-dependent malate dehydrogenase (oxaloacetate-decarboxylating)
Physo_136641hypothetical protein
Physo_108965predicted protein
Physo_136643hypothetical protein

Sequence
4098 bases(100 bases per row)
AAGATCCATATAAATACTTCGCTGCGTTGATCGTGCTGCAGGCCTGGGCCTCAGCGTAGACACTGATCCACGCGGTGCATCGGTACCACGGCAACTTCGA
GGTGCCACAAAGGGGGACGATGTTTTCGTATTTCTGCTTGGTTAGTCGCAGCGCGCTCCTTTGCAGCACTGAAGCAACCAGCGAAACGATTTGCTGCGTA
CGTACTTCTATGAGCCCAGCTCACCTTTTGCTGGGTGTGTGCGGGGCCAAAAGGGCAAACTTGGACACAAGCGCGTCGAAGAGATCTTCGTCCTCCTCGT
CTTCCGAGTTGTTCGACTTGCGCACTGCATGCAAGCAGCCCGTGACAGATCCTCGTGGGGCGTCGATGTCCACTCCACTCGCGTACTCAAAGGTCTGGCC
AGGAGCCAGCAGCGGTGTTGCGCCGACGATCCCTGGTGAGTTCCGAGGCAGCGCGACCCGCTGACCCTTCTCGCTCTCGAACGTGTATTGACGACCCAGA
ATCTGGACCGAGCACTCCTCGTCTACATAAATCAGAGGCACAAAAGCAGTCACACCGTGAGCTTTAGCACTCTCATTCACTGCATGCAGAGCTCACACAG
ATCGGTGCGTCCATTCTTACTTTGGTTGGTGATGGTTACCCGATACGTGAAGCGGTAGGTGTTGGAAGCTGGGTTGCTGTGGCTCTGCACGTAGTGGCTC
GTCGCCTCAATGCGGATACCGTTTGTCACAGTCACTGCACAGCAACGCGCACTCTCATCATCAGACGGACGTCCAACCCAAATCATACAATAGTATTGTC
ATCAACTCCTACCGCTCGAGCATTGAGCAAGAAGAAGTTGCGTGGACAGCTCGCCCAGCGCTCTAGAAGATCCAAAACCCCAATGTTAACCACCCGACAT
CCAGCGACACAATAGACAACTCAACATACTCGATGGCTTCATCCAGCTTCGCACTCCTAACCTGTCAGCAACCCAATTAATTATTGTCAGTTCCTTTTGA
CACGCACCAACCAGATTTCCAGCTCCCATCGCCACCTTCGCGTCCCTCAGCTGCATGTTCTCTCGGAAACCCGCGCGGATGCTCTCCATAATGTCCACAC
TGGGCGACCCCATGCGGACGGCATTGTCTCGCAGCCGGTAGAACTGATCCAGCGACGTGAGCACCCTCGGCCCCTGCGCCTGCGTCAACGTCTGCAGCTC
CTCCTTCTCCGCCTTGGACAGCGGCTCCACGAAGCTGCCGGTGCCCCACTGCTCCAGCTGCAGCTCGCGGCGGATGTTGAAGTGCGGCGTACGCTGCAGC
GCCCGCGCGTCGCGCAGCAGACAGCGGTAGATGGCGCGGACCGTCGCCGGCGAAGACATCAGCGTCGTCTGGGGTGGAAAAACAACTATGTGTTTGGTGT
ACACCACACTATCGTTACTTCAACATCAAACGTAGTGTGCGCCACACCAGCCTACTTCAGAGGGGGAAGATTTTTTATAGCGGTTCACAAAGATTGCATC
TGTAGCTGCTCGCGTAGTGAGGTGAAGCGATGGCGGCCGAAACGACGACGACGGCGACGCACAGCAAGCTGCAGCTGCCCGAGGAGGTGGTGACGCACCC
GCTGGTGCTGCTGAGCATCGTGGACCACTACAACCGCGTGGCGCGCGACACGAGCAAGCGCGTGGTGGGCGTGCTGCTGGGCTCGACCTTCCACGGCAAG
TGCGACATCACCAACTCGTTCGCCGTGCCCTTCGACGAGGACCTGCGCAACCCGGGCATCTGGTACCTGGACCACGACTTCCTGGAGAACATGTACCAGA
TGTTCAAGAAGATCAACGCCAAGGAGCGCATCGTGGGCTTCTACAGCTCGGGCCCCAAGATCCGCAAGGCCGACCTCGACATCGACGACCTGTTCCGCCG
CTACTGCCCCAACCCGGTGCTGGTCATCTGCGACGTGCGCCCCAACGTCGAGGGCCTCCCCACCACGGCCTACGGCTCCGTGGAGGAGGTGGAGGAGGAC
GGCAAGGCCATCAAGCGCGTCTTCAAGCACATCAAGTCCACCGTGGGCGCCTACGAGGCCGAGGAGGTCGGCGTCGAGCACCTGCTGCGCGACATCAACG
ACCCGTCCGTGAGCTCGCTGGCCGGCCAGGTCAAGCACAAGATGACGGCGCTCAACGGGCTCAAGGAGCGGCTAGAGGAGATGAAGACGTACCTGGAGAA
CGTGGTGGCCGGCCGCCTGCCGCCCAACCACCAGATCATCTACAACATGCAGACCATCTTCAACCTGCTGCCCAACCTGAACGTGGACGAGCTCGTGCGC
TCCATGTTCATGAAGACGAACGACATGCACTTCGTACGTAGAGTTTTGATTTGTTTTTTAGGGGCGTACTGATGTTTTATTTTATTTGTTTTTGCGCGGC
TGCAGGTGATCTACTTGTCTTCGCTCATCCGCTGCACGATCGCGCTGCACAACCTCGTGAACAACAAGATTAAGTACAAAGAGTCGGAGGAGGTAGGCTT
CACGACGGAGAAGAAGGAGGAGAAGAAGGACGCGGCTGCCGACAAGGCCGCCAAGGACAAGACGAGCGAAAAGGCCCCGTAGAGTTGTCGCGACATAATG
CGCTGACGAAGTAAGTCGCGCTCCCAATGAATGACTTTCTACTCTAATGGCGTTCTTGGCGTCACTTGCACTATGACACAAGTTGTCAGGCGAAGGCAAA
GGAAATAGCTGGTCGGGTCGGGTCGAGTGTGGTCCAGTTTTTCCCGGTGCGAGATACAAACGACGTCGTGATGGTGATGCGACTGTTTTGTCAAGAGCGA
AAATGACTAAACGGATCCAGACGGGTCGCTTATAGGAGACTTTACCCACTTACTGCTGGTGTGCGCGCCTGCTAGGCCTTTTCGATATTCCAGCACGTCG
TTCACTTCCGAATTCGCCAGCCCGACACTCCAGACCCGTACGTGAAAATTCACGGATTTCAAGAAAGTCGATGGAAACTGGAGAAGAAAACGCCAAGCAA
GGTGGCGATGGACTGCAATTGCAGTCGTCAGACGTTGTCTCGCACACCTCGGCAAGCGCGTTCATGGCTGAAGGACCCGACGCGTTTCACCGCTTTGTGG
CTGACGAGTTGAGGCTTGCTGCGGGGCAGGCACTCCCTCGACTTGAGATCCGTGTGCGCAACCTCTCGCTTTCGGTGGAGACGCCCGTGACACATGACGA
CGCAGCGGGTGCAGCTTCCTCGGAGCTTCCGACTTTGCCCCGAGTACTTCATCGTGCTGTGACCAAGTCGCTTGGTGCCTGCATCCCGTCGTTCCTGAAG
AAGCACGCTAGGCGTGACAAGCAATCAGCAAGGCGCTACATTCTTCAAGACTTATCGGGCGTCTTCAAACCGGGGAGTATGACGCTTGTACTTGGTCAAC
CAGGGTCGGGGAAGTCGTCGTTGCTGCAACTGCTTAGCGGTCGGTTCCCTCTGGAGAACAACAACGTCGCCCTTGAAGGTGAGATCGCGTACAACGATGA
GCCTCGTGAATCGCTGGATCGCCGCTTACCGCAGTTTGCAGCCTACGTCGCCCAGCAAGACCTGCATTTGTCCACTCTCACGGTCCGTGAGACGCACGAG
TTCGCTCACACGTGCAGCACTGCGTACTTCGGCAACCATGTTGAGGAACTGTTGAGTCGCGGAGCTCAGCCTGAAGACAACGCAGAGGTTCAAGCTACAG
CACGCTCGTTGTTGCGTCACTTGCCGCAGATAACGTTGGAGCTTCTCGGCCTGCAGCAGTGCGCAGACACGATCATTGGCGGCAATTTACTGCGCGGGGT
GTCCGGTGGCGAGCGCAAGCGCGTTACTACCGGAGAAATGCTGGTAGGCTTCAAGCTGGCTCTGTTCTTGGATAGTATCACCACTGGCCTCGACAGCGCT
GCAGCCTTCGACATCATTTCAAGTCTGCGTGGCCGAGCACGATCCTTTGGCCAGACTGTCGTAGCAGCACTACTGCAGCCAGCGCCTGAAGTCTTCGAAC
TATTCGACGACGTTCTGCTGCTGATGGGCGGTCGCGTGGCTTACCACGGTCCTGTAAGTGAGGTGCGAGGCTACTTCGAAGCACTAGGCTTCTATTGT