Description :
From Genome Similarity Track
Location :
Scaffold_15:150218- 155240
Sequence
5022 bases(100 bases per row)
GGAGTCGAGGAAGACTCCCTGTTGAGATGGTTCCTCGAAGTGGACGATGCCATTAAGGCTCGCCACATCGACGACGAGGAAATGCAAGTTGCATTTGCCA
AATCGAATTTGTCAGAGCGTGCTAGAACTTGGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGAATCGTTGGCGGTCTATAAGACTCTGCTCAG
CCAAACGTTTGAGCCGCTAAGAGCTGAGTTCAGGCCTCTTACAAAGCTCCTGAAGATGAAACAAGGTAAGCATGACGTTCACGCTTACGCTCAGCACGTT
CGTTATCTTGCAAGTTGCATCGTAGCGAACCCTGTAAATGAATTCGTTTTGATCACGATATTCTTACAGGGCCTCATAGATGGTCCCGTGAAGAACCACC
TATTCCGCATCGAGTTAAAGTCGCTTGAGGAAGCGATTACAACTGCGTTGCAAGATGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCCCCTTTCG
TCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGTGTTGAGAGCGAGAGACCTCGCTCTTCAAGAAGTAAGCAATTGTAAAAG
TTCAATCGCTGTCAGAAGTTAGGATACTACGCCTACGAGTGTAGTGCTTCACGCCCAGTATCTCGAAACACTGAGCGAAGTGATCGACCGTCTGCCAAGA
ATGGCAACGGACGCGGGTCCGACGCTGTTGTGAAGTCAAAAGAGCGTGGCGGAACGTCAAAACACGGTCGGGGTTAGTAGGGGAGGAGCGCCCTACTGAT
CCAGCAACCTCAATAGAATTTGCAAATATATTGATGAAAGTTGCTCCAGACTCACAATCCTTGTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATCA
CCTTGAATTTAGAAGTGACAAAAGATATGTCAATTCGTGCCTTAGTTGACTGTGGGGCGTCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGATCGTAG
GCTCAAGTTCGTTGAGCGCGTTACTCCTCCCACGAGGCTGATGGTGCGCCTCGCAACAGGCGCATCTATAGCAGTGATACAAAGTGTAGTGGGAGTTCAG
TACAAGTTAGAAAATTTGCAGTACAATGATAATTTCATCGTACTTGATTTGGATGACAAATTTGATGTCATCCTAGGGTTACCCTGGCTCAGAAGGTATG
AGCCAAGGGTCAGCTGGCAGCATCGAACCGTGAAGATGCCTGCCACTTGTTCATCAGATGGCCATTTGATGAACGTCTTGGAGCGTCCACAAGCGTGTGG
ATGTACTGCGAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGGAAGCT
GCCGGCGGCTGTGCGGATGCACAGGCAGCGCCGAAAGTCCACCACTCGAATAAGTCGAGTGGATCGGGACATGGGTGTACGCCTAGCGGGCGACATCTTA
GTAAGAATAAACCGGTTGCCCACACAGGGCAACACGATGATCCTAGATCGGCTGGAGAGTCGATCGTAGAGGACATAGCTGTGGTAGCGCAACCACAGGT
AGAAGGCGTCGAAGGAATAAGCCCCCAGCAGCCTGTGAAAAAGGGTTCCCAGGAAGAAACTGAGACATTGAATGTCTTGGTTAATGATGGGTCAAGTGTA
GGCGCTTATACACTTGATCTGATCGCACCTCCGAAGTTGACTTCGGAGATCACTCGATTGCCAACGCTAGAACCGAAACGGTTCTTGCGAGATATGCGTA
GTGGCAAGGTCAGGCAGATCTGTTTACTCGTCATGGAGGAAGAATACATGACTGACATTCTGTCGGTAGTAGTATTTGCAGAGAACGAACGGGTTCTCAG
CAGTGCATCAATGGACAAAAGTAACGTCGATGAGAAGACTTGAAATGAGAGATACACGTCTCAATCTTGGGAGTCGCTCCAGGCAAACAAAAATGTAAGG
ATTTGATCGAGTTCAAGGACGTGTTACCTGAATCCGTACCATGCGAATTGCCTAAGGATAAAGACATTCGACATGAAATCGAGCTCAAACCGGGCTCGAA
GTACTGTGTCATGAAGCAGTGGCCACTGCCTCGTGAACAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGGGGGTGAGGGAGTCAA
CTTCCCCTCACAGCTCTCGGACCTTCTGTGTGCGCAAGGCCACAGGAGGATGGAGGATAGTGCACGCGTTCAACAAGTTAAATGCTGCAAAACGGTACCG
GCTCAGACGCCGATACCGAGGAATGACGTAATCATTGATGGTATGTCAGAGTACCATCTTCTCGTCCATGGATCTGATGGATGGCTTCTACTAGATCCTA
ATGCGTGAACGGGACATCCAGTACTCGGCAGTAAGCACCCCGAGCGGTATGCTCTGGGAGTGGCTAGTAATGCCACAAGGGCTTAGCAACGCCTCTGCCA
CATTCAACAGATGCGTCACAAATCTGTTGAGACCGGTGCTAGACTTCGCACCGAGTTACTTCGACGATGTATTCTTCCAAGCCGGGCTATGGGCGGAAAG
GCGGACGTAGAGGCTCATAGAACACACGTTCGTCAGGTACTTACACTTATGCGCAAGCATAAGTACGCCAACCCCAAGAATTGCATATTCGCTGCTAGCG
AAATACCACTTCTTGGGTGCATCGTTGGTAAACACGGCGTACGCCCTGATCCTGAAAAGATCAAGGCGATTACCGACTGGCCTGTGCCAGTCGATGTTAA
GGGACTAAGATAGTTCCTTGGTCTAGCGGAGCACTTACACAAGTACTCGTGCAACTACGCTGAGATGACCGTTCATCTTCTCGTCTCTTGAAAAGAACGA
GAATCGGTCATGGAACACGTATTATCAGCTTTCCTTTGAAGGTATCAAGCAGAGCTTGATGCAATCGCCCATCTTGGCGATTGCAGACCAAGACAGACCA
TTCCATGTGGTCTGTGACGCCAGCGATTTCACACTCGGCTGCGCGTTAATGAAGTACGATGCAGACGGCGCAGAGCGTGTCGTCTGTTATCAATCGTGTC
AGCTGCAAGTGAGTGAGCGTAATTATCCAGTACACGACAAGGAATGTCTTGCCATGAAATATGCACTAGCGAAGTTTCGCGTCTATCTCCTTGGAGATAG
GCCGTTTGCAGTCTATACGGACCATGCGTCATTACGCACGGCCGTAAACATCCCACACCTCTCGCAAAGGATGGCGACGTGGCTGTCCTTCTTTGCGTAG
TACAACTTCTCCGTAGGGCATAAATCCGGACGACTCAATGTCGTCGCGGACGCGTTATCGCGCCGGCTTGATTTCGAGTCGGCTGCGCAGTCCAACAGTG
AGGTTGATACCACTGTTGTAACACTAGTCACTAGTGTTCCGTCGTCAACATTTCTTGACGACATAAAAAGGCCTACGCAGAAGATAAGGCTCTTCTGCGA
CTAATGGATCATCTGGTGACTCCATTCCGTAAATATCTCAAAGATTTACCGGCCTTGTATCAATCTTCCGTGGATCGATACACAACACGCAACGGGTTGC
TGTATTATACAGCCGTTGCCGGCGACACACCTCGTGTCGTCGTCCCCACTCATAATGATTTGCGCTTGCGAATCTTGTATGAGTGCCATGATGCACCATC
TAGTGGGCATCGTGGGCATGAGAAGACTTATCTCACGGTAAGTCGCGACTTTTACTGGCCCCGCTAGTATCAGGTTGTGCGCAAGTACATTCGTGCTTGT
GAAGTGTGCCGACGGGTGAAGCCCATTACTTCATCCCGTGCGCCACTACAGCCTCTACCAATCCCGGCAGAGTGCTGGCAGTCTGTCTCAATGGACTTCA
GCTTCGGTTTCCCCGAAGACGCTCACAAGAATAATGGTATTCTTGTACTCGTTGACCGATTCAGCAAGATGGTACATCTTGCTGCAGTTAATGAGTCAAT
CTCAGCACATGGTTGTGCCCGTTTCTTCATTGACGCGGTATTCCGACTCCACGGTCTACCCCGTGAACTAGTCTCTGATAGAGATCCTCGGTTCACGACG
GCGTTTTGGCAATCTGTGTTCCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGATGGTCAGACAGCACGCGTCAACCGCG
TTCTTGAAGAGATACTTCGAGGATACGTCCAATCTTTCACAGATTGGAGCGAATTCTTGCCGATGGTGGAGTTTGCAATCAACAACTCCGTGCATGCATC
GACAACGCATACAACATTCTTCGAGAATGGCTTACGCCATCCACACCTACCCACCCATTTCAGTGTGCCACTAATTCAAGGAGAGAGGGATTCGCTCGAG
CAAAAACCGTTCTGGATCTTGCTCATCACGTGTCGAGGTAATCGACGACGCGAACGTTGCCGATGTCGATCAAATCGACATCGAAGCTGATAACCTTATC
AATAGTGATGACACTACTGCTGACCCAGATGAGGATGACGATGCTGGTATATTCAGCATCGCCAATGACTACACCAACGAGAATGATAACACCCTCGCTG
AAGAAGAGGATGACCTCCTAGCGGTGCGCACAAGGAGCACTGCAACAAGCCAAAGTAAGTTAGCAGAAGATTTTCTGCTGGCACGAGAAGCAGTGGTCCG
TTTCGTGCAAGACTCCATCGCTACGCGGTGGACCGGCAGAACCAGAACGCTAACAAACATGGAAGAGCGAACGTTCTTCTATACGATGTTGGAGCCTTAG
TTCTACTGTCTAATGTAAATCTATCTAAGCACGTAGTAACCAATGTGGGTAGCGGTAAACTACTATCCAAGTACATCGGCCCGTTCCGTGTGTACTACTT
TGCAAGGGCAATGCGTACACAATCGAGTTGCCTCCCAGGATGCGTACGCATCCTACAATTTATGTCGGTCTTCTCCGCCCGTACCATCACCAGGAGGTCT
CTTCATCGGGAGACAACCGCCA