Description :
From Genome Similarity Track
Location :
Scaffold_37:1502085- 1506624
Transcript NameFunction/comments
Phyin_T30-4PITG_15511Crinkler (CRN) family protein%2C putative
Phyin_T30-4PITG_15512Putative uncharacterized protein

Sequence
4539 bases(100 bases per row)
ACGGATATTCGGATGCGTGCAATGGAATTTGATGTCTGGTCGTGGACATTGGCTGAGTACCTTGATGCGGTTAAGGAACGAGATTTTTTGATGTGCGTGG
CGAGTATGTTGGATGCTTCAGGCGGCGTATATGGACCAAGGTCTCCTGCGGAAATGGTAGAGCTGAAGTATCACTATGCTGGTGGATCATGTCGCTACAT
GTTTGACGATACGACCACCGACGTCAAGACCAGACTTTGCCGAGCCGTGGAATCCACCTCAAGTGCTGCCACTCTCTCTTCAGAAGGGCACCGCTCACAG
CTTTGCATCAACCGGCTTTTCGCGATGTTTAAGCGACCGAATTGGGAAGGTACTGTGTCGCCGTTGATCAGTCGGTATGCTGCTACTACAGTTGGTATAG
TATGCGGTCCGGAGGCTATCAAAAAGTTCATGTCTACACATCGAGACCATTCAAACCCAGCACTGAATGGATGGATGCTGGAGATGGCGTTCTTCTCAAG
TCTTCGACAGGGCGGTCTCGAACTTGTCGATTCAGCAGGAAATAAGCTTGACTTGTGGGGTCAATCAGCTATTGTGGTTTCGGATGGAATACCCGAGCTT
TCTTGTGCACGCCCCGTATGGATTAAGCCCGAAAAATGGAACCAAGGTGGATATGATGCTATCATGGTGTGTAAACGTACTCAGCACGTGCGTTTGGTCC
AAGTGACGAGTGCCCACAAGCATTCTTTTCGCATCGATTTCTTTTACCAATGGCTGAAGATGCTGTCTGAATCGCCGGAAAGTTTTGAGGTGAAGAAATT
GGAGATATTCTTTGTGGTCGAGCAAGACAAGCTGAGCGCGTTCGAATTCACAACAACTGGAGAGGGACTTCTAGACCCTTTTGAGTGGCCGAAAGGGAAG
GAGACTGAGCTAGTGCAACTTGTTGGGATCCGAGGGTTATATAATCTCTCACAGTAGCATTCAGTATGATTTGATGTCAGCAAAAGTACAGTTGTAGTCG
AAGTTTTACAGGCACATTTAGTATTATTTAATACTTACGTATTATAGTACTTAAAATATTAAAAATGTGCTCTTTTTACCGATCATGAAGTCTGAACTTA
CTTCCCACACCTTGTCACTACGTGACCGACTCATTTGGCTGACACGTATTGCTCAGCCACGGAAGTCGACTTTACATGTATAACGCGTCTTCGGATTCAC
TGTGTACTTCCTCACATTCTTCTGCATCTCATCACGGTGGTGGCCGGAGAGACGCTGCATAACCTGGTAAGCAAAATGTCGTTCTGCGAGTAGCTGTTCG
TCTGTCTTTCTTCCGATACGAGCAATTAACCAGGCGCCATCCAACGCACTCAGGAACCCTCGGCAAGTACCAACACCCTCGTGCCACACAGGCTCCAACA
GCGAGTCACCGACGAGCCCAACGTAGAGCTTTTTACCTTGCGATACCAAGATATTTGCAGCCTTATCAGCTCGTGTCAGCTGGCTAAAGTCGATGAGATT
CACCCTCGTGAAGTCCGTCTTTCGAGTGATACCCGCAAACCTGACGATATTCTTGACAAACACATTGAGCGCATCATGATTGACGTTCTCCTTCCGCACC
AGATCTTTCGCGTCTGCATAGTTTTGCTTCACCACATCATGGGTCAGCAGGTTCTGACGCTTTGGCGTCATGACCAGATAGTGCATATCTCCTCGAAAGT
ACACGACGTTCTCGAGATCAATGCCGACGTCGCGCATCTTGTCTAACATGTGATGTTTGAGTCGAGTGGTCCACGAAAACTCCTTCGTCTTCAGTTCGTC
TGTTGTCTCCAGGTTCAGGAAGTAGCACACGATACCCAGAGATTCGTTCCGAGAGAATACGAAGCGGGTGATACCTGCAGACTCCGCGACCAGGTCGTTC
GTCCCGGTCGCACCGAGCACCGCCGTGTACTCTGCGACTGGGATCTGAGGCTCTGTCTTGATACTGTAGAACGGGTTGCCACCGTTCTCCTCTGGCGAAA
CTATCGACTTGAAGCCTGTAGCAGAGTAGACTTTGACGCCCACTAATAGAGCCACCTTGAGTAGAACCACCTGCAGCTGTCGTGTGCTCACGTGGAAATA
CGTCCGGGATTTGCAGAAGTTCTTGAACAGAACTTTCGCTCCTAGAGACGCCAGATCTTGGACGACCCACGGCCACAGGTGGAGCATATTTTCTCGACTG
AACTTGGTCCGTTTCTCGAGGACTGTCACTTTACCACCGAGTAGTGCCAGCTCAATTGCGGCGCGCAGCCCCACGGGGCCGGCACCGACGATACATACGC
GTTTGTTAGCGCAAGGACGTCGTTTGAATACGTCCAGACTGAATCGCACGTCCAGGAGCTTGAAGAGCTGTTTGTGGCGGAAACTGAGCTTGCTGTAAAC
GGCGTCTCGGATGTGGTAGTACACGTGCCACGGCTCCTGCAACTTCACGCCGTCGAGACAACAATCGGCCAGCAAATTGTTGAAAGCGGCCAACGTGTCG
CGCAGGTCTTGACCGGAAGCGAAGGCTTTGAAAGACTCGCGAACGGTTGGCGCCACGTCAGTTTGAGGGTACGAGGGCGGTATATCTACCACGGAATACG
TGTCGAGTGAATCGGTCGAGCCGTTGGATGCCTGTGTGCTAGAGAGTCGACGACTCCTGCTCTGGTTGGTACTCAAATCCTCCCGCACGACCTGATCGAT
CGAGTTTAAATGCTCTGACACTCGAGCCATCGTTGCCTCAGACAGCTCCATTCTTTGACAGGTTTTGGTCACCTGTTCTAGCGTCGCCAAGAGCTGCCAT
CGGGTAGGCGAGTTGCCGCTGTATCCGGGCAAAGAACGCGACGATTTCGAGCTGGTACTCTCGCTGTCTGAGACGGATCCTGCGCCTAGAAATTGGGCGA
GTTTACTCGCAAATGTCTGCGGTGGCTGGACTTCCACTTCACGGCGTGACCTGTTGCTGTTGAGCGAGAGGAGTTGGGGTGGCTGGGGCGTGTACGCCGC
CATGGAATCCAAAAGCCTAACGGTATTGCAGCTCTTACCGTCACTTGCGTCGCTACGAACTGCAGAGCGTTCCGCGGATCGACTAATGCTCTTCGCGTGT
CGACGCTCGTGTGTCGAGGCCTTCTCTTCTTCTTCGATCAGGAGCTGTCTCACCTTCAGCCACGCTAACTCCTTCTCTGTCCGGACTCGTTCTTTGTGTC
CTACCTCGTGGCCATTGATCGAAGACGCGGCCAAGTGATGTCGAACCTGTTCTGCCGCTTTGTTCTCGTCCGCACCGTCTGTATCTTCCTTATAAATGTC
GTCAAGGTACTTTTCTCCAACATCGATTGCCAAGTCATCCAGCACCTCGCGACGACGTTGAGGAGACTTGTGGTCGATGTCGATATCTCCGAGGTTGTCC
AGACTGTCAAGTCCGTTCGGGTCAATGAGACCTTCGCCGACGTAAGCTACACGACGATCCATCGCTCGGGGACGGTCGAATGGGTTGTGATTCGGAACTC
TACGGTCACTACCGTTGGCGTACTTGCTCATAGATTGGTCTGATGATGCCATTGTTCACCAACTCGACGTAAACAGATCTCTGTCAAATCGGCACTGGCG
AGACTGTGGATATTTCGCAGCACGAGGCTTGCGCCACGAGCGCATGACAGATTGGGGACACGTTGGCATCGATCCGTTGAAGGGACGACATGAAGCTGTG
GTCTCCATCCAACAACCAGCCATATCGGGGTCTCTACACAACATACGGGAGTGATGCATAAGAGTGCTGTAGGTTTTCGTCTACACGTACACCGCTCGCG
TCTGCTACAGCTTCACTGCGTTTTGTATTAAGACACAGTGACACTGTGACGGTGCACGCTGCGCTTGGTCTTTTCTTACTTCATGTTTTCAAAATCTTCG
TGAACATGTTCTTGTAAGGACCGTATCCCCATTTGTGTTCCGTCGTGACGAGCGTACTACCCTGCGTAGACAGTGAGGAGTTGAACCAGGCGGTCATTGG
GAAGGCTTCGTGACGTTGACGGCGGTGGTCCGCCGTTGATGGCAAAAGACATGTACTTGTACGCACCGGTAATTGTATTATTAAAGACTTTAATACGTGC
AACACTGGTGCGACTCGCAGCAGCGCTATTCGTGCTGCAACTTTGTTTTTGTACACTAAGGCACGGAGTCAGGCTCAGCACTGCAACTGAGTTTTCCATG
AAGCAGCTTTTTCGATGGAGCTGCTAAAATATGGCAGATTTATTGAAATAGCTATTTTAAGGTAAATCACGTCTTTCAATTGGTATTTCACAAGCACGGT
CAGAGTCCGACTCGTGATACAACGTGCGATGTGTGCTCAAATCGCGTGAATCGGCAACAACGCAGCGAAAAGCCCGCTACTTAAGGTACGGTTTTATTTT
AAGAAAAATAGTGTTTACAGTGATCTGCCTTAATATACTACTCTGAGAAACTTATAAACTTAAATGGGTGAGCTTTAATCAAATTACCTACCTCGTATTG
TGGATAATTAGGCTCGAATTAGCTATATGTGACCCGACA