Description :
From Genome Similarity Track
Location :
Scaffold_246:15020- 16945
Transcript NameFunction/comments
Phyag_g3914heat shock 70 kDa protein, mitochondrial precursor

Sequence
1925 bases(100 bases per row)
aactCAGCGTCGTGCAcgttctcgtccttgttgtcgtcgccgGCAGCGCCCTCGCCCTGCTGTGACTTGTAGACGGCCTCGCCGATCTTCATGGACATCT
TCTGCACCTCCTCGAGAGCagccttgatctcctccgtGTTGTCGCCCTCCGACTTGGTTCGCAAGTCGGCCAGAGCGGCCTGGACCTTCTCCACGGTCTC
CGCGTCGATCTTGTCCTTGTGCTCGGTCAGGGTCTTCTCGGTCGTGTACAGCGCAGAGTCGGCCTCGTTCTTGGCCTCAATGAGCTccttgcgctgctgg
tcaGCGGCGGCGTTAGCCTCAGCGTCAGCAAccatcttctcgatctcagcCTCCGACAGACCGCCGCTTGACTGGATCACGATGTTCTGCTCCTTGCCCG
TGGCCTTGTCGCGGGCGCCCACGTTCACGATTCCGTTAGCGTCAATGTCGAAGCTCACCTCAATCTGCGGCACGCCACGCGGGGCAGGCGGGATGCCCAC
CAGGTCGAAgttgcccagcagcttgttgtcAGCAGCCATCTCACGCTCaccctgcagcaccttgatgCCCACCTGGGTCTGCGAGTCGGCAGCAGTCGAG
AACACCTGCGACTTCTTGGTCGGGATCGTGGTGTTACGCGGGATCAGCTTGGTGAACACACCACCCAGGGTCTCAATACCCAAGGACAGGGGCGTCacat
cgagcagcaggatgTCCTTCACGTCACCGCGCAGCACACCGCCCTGGATGGCAGCgcccatggccaccacctcaTCGGGGTTCACGCCCTTCGAGGGCTT
CTTGCCGAAGAACTCCTCCACGGTCGTCTGCACCTTGGGCATACGCGACATACCGCCGACCAGGATGACCTCATTGATGTCGCTCTTGTCCAGACCAGCG
TCCTTGACGCACTTCTTGCACGGGCCCATGGTGCGCTCAATGAGCTTGCTGACCAGCTTCTCGAAGGTGGCACGCGTGATCTTCATGTTCAAGTGCTTGG
GGCCGGTGGCGTCGGCCGTGATGAAAGGCAGACTGATGTCCGTCTGGGCCAGGCCATCGAGCTcgcgcttggccttctcAGCGGCCtcacgcagacgctg
catGGCGAGGTTGTCGCCTGACAGGTCGATgctcgtctccttcttgaactcgtccacgaggtagcgcagcagctcctcgtcgaagTCCTCACCGCCGAGC
AGCGTGTCACCGTTGGTGGACTTGACCTCGAACACACCGCCCGAGATCTCCAGGATCGACACATCGAAGGTGCCGCCACCCAGATCGAAGACAGCGATCA
CCTTGCCGTCAGCCTTGTCCATGCCGTAAGCCAAGGCAGCAGCCGTGGGCTCGTTGATGATACGGAGCACGTCCAGACCGGCGATCTTGCCGGCGTCCTT
GGTGGCCTGACGCTGCGAGTCGTTGAAGTAAGCCGGCACCGTGACAACGGCCTGGGTGATGGGCTTGCCCAGGAATCCGTCGGCggtctccttcatcttg
gtgaGCACCATGGAGCCGATCTGCGACGGCGAGTACTTCTGGCCCTTGGCCTCCACCCACGCGTCCTTGCCGTTGTTGCCCTTGACGATCTTGTACGACA
CGACCTTGGACACCTCCTGCGTCTCCTTGTCCTCGAACTTCCGGCCGATGAGACGCTTGACTGCGTAGAACGTGTTCTCCGGGTTGGTCACGGCCTGGCG
CTTGGCGGGCATGCCCACGAGACGCTCGTCGTTGTCCAGGATGGCCACGACCGACGGCGTCGTGCGCGCGCCCTCCGAGTTCTCGATCACACGCGCGGTC
TTGCCCTCCATGACGGCCACGCACGAGTTGGTCGTGCCCAGGTCAATGCCGATGACCTCGGAGCCGGCGGCGGCCGAGAACAtgcgcttggcggcggcgg
gggcggcggcggagcgGGCGACGGC