Description :
From Genome Similarity Track
Location :
Scaffold_483:1502- 7987
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_483-fgenesh-gene-0.0Serine protease family S09X
Pytiw_DAOMBR242034maker-piw_contig_483-snap-gene-0.9Conserved gene of unknown function

Sequence
6485 bases(100 bases per row)
TTTCAAGGTAAACATGGAAATGGTGTCAAGACTAACTTGGCCGTTTTACTGGCCATAACCTCTTTAATACATCAAATAGCCAGCATATCTTGCTTAAAGT
ATATCAGAATAGCCACCATCGCTCATACAAGAACTTACCGCAACTTTTCGTGAACCCACATGTCCCGTCTATGCACACAACCTCTCATTTCTGATGATCG
AATTTGAGAGGGTATGGTACCGAGCAGCTCATTTCAGCCAGGAAGAAAATCACAGAAGCAAATAAAATGGCGGAAGATGGCGTTGGCGGCAGTGGCGGTG
GTGCGTCTCTCTCTCTATGGGACGAGCACTCGTGCCTCATAACCACACACGCATCCTCACAGTCTCCACCTTTGTACCTCATATTTTGTGCAGCAGCAGC
AGGCGAGCAGCGGCGCACGAGCATGTGGGCGGCCATCAAGGAGGGCTACGAGGGGCTCGTGATGACTGTGATCCGCCCCATGCGTGCGCAGTACACGCTC
GAGGACCTCGGCCCCAAGCACGCACTCATCAACGACGTCGTCACGCACCGCGTGGACATGCAGCTCAAGAACGCCGGCGGCTACGCGCTCCAGTGCAGCT
GGTGGAAGCCCAGCACGACCGAGAAAGGGTGCGTTGCATTATATATATATTGGTTTCAGTACGAAGAGCTATACTCATGTCTTATGCTGCGAATGGACTG
CAGAGCCAAGCTGCCGTGCATCGTGATCCTGCACGGCAACTCGTCGTGCCGCCTGGGCGGCCTGGAGATCGTGACGCACGCGATCCCGGCGGGCTTTAGC
ATCTTCGCGCTCGACTTTGCCGGCTCGGGGCTCTCGGACGGCAAGTACGTCTCGCTCGGGTTCCACGAGCAGAGCGNNNNNNNNNNGGAGCTGCGACACC
CGAGCCAGCACCAGTCACAACAGTGGTGCTCTTGTTTTTGCCAGTCGGTCTTGCATTCCGCTCGGCGGTGTTCACCTCTGCGAGTGGAGCGATCGCGGGC
GCGTCCAATTGGTCCTGTGAGAGGGATGCAGCGCCCTCGCTGGTGCTGCTACTTGGTGGGTCAACGCGGTTGCGACGCGGCGCCGTCTCGCTACGTCGGA
CCTGATTCGTCTGTTGCATCTCGACCAGCGAGCTGAGCTATGGGCTTTCTGATGCTTTGCGCCTTGTGTGACGAGTTGCGTCATCCAATTCCAACTCCAG
TTACGCTCTAATTCTGATTGGCGAAAAGAAATAAAATCGTAAAAAGAGAATGAGAGAACGAGGATGAAGACCAACAGAAGTTGCCAGAAGCTTCGAGCGC
TACGAGCAAACTAAGCGCAGCGCCATACACGCAAAGACAGCGAGATTGGACACGCGCGAGGACTACATGCCAGTGTAAAGAGCACCGGCGGCTACTCTCT
CCAGTGCGACCGAGAAAGGGTACGTTATATGCATCTATATAGCAATACGAAGAGCTACACACACTCATTTGTGACGTTGTTGCTATTGATTCACTGCAGA
GCCAAGCTGCCGTGTGTCATGATTCTGCACGGCAACTCGTAGTGTCACCTGGGCGGCCAAGACCGTGACGCACGCGATCCCGGCGGATTTCAGCGTCTTC
GCGCTCGACTTTGCCCGCTTGGGGCTCTCGGACAGCAAGGACGTCTCGCTCGGGTTCCACGAGCAGAGCGACATCGCGACCGTCGTGGGGTGCCTGCAGA
AGATGGGCGAGACGTCGAGCGTCGTACTCTGGAGCCGGAGTATGGGCGCCGTCGCGGCGCTGCTGTACGTGTAGAGCGACCCGCGCATCAACGCCATGGT
GCTCGATTCGCCCTTCTCGAGCCTCCCGCGGCTGGCCACGGAGGTCGTGGAAGGCGTGAAGCTGGGCGTGCCCAAGATCGCAGTCAATCTCGTGATGCGT
TTCATCCGCCACTATATCAAAAACCCGCCAAGTTTGACAAGGTCAAGGTCAAGCCCGTCGCCAAGATCAACAAGTGTACAATCCCGGCATTATGCGTGGT
CGTCTCGCGCGACGAGCTCGTGGAGCTGCACAGTGTCACCGCGCTCCACAAACTGCACAATGGTCCGAACTAGCTCTTCGAGTTCGCCGGCGGTCACAAC
AGTCCGCGTTCGAACAAGTTCTTCGCCCGTGCACCCAGTTCCTCCGCGTGATGATCGGGTAGCTTCCTCTCCACTTGGAGACGATGCTCAACAGCAATGG
CTCAAGTGGCGGCTCCAAGAAGAAGAAGAAGGAACAAAAGAGACTCAAGGTGGTTAAAAACAAACTCGCTCGCGGCGAGAGTGTCGAGAAAGTGCTTAGA
TATCCAACAAGCAGCTCAAAGAGGCCATCGACTGTGTCGGCTATGGGTAGTCGTACGTATCGAGAAGAACGAGCTCGTGGACCTCGTGCTCAAGCTCTAT
GCAAAGAACTTGCGGTCCAGTCAGCAGTACAGTGAGGATATCTGGATGCAGAGACTGAGGGCCCGATTTTATTTACAATCGCAATGTCTTATTTGACCTG
CTGTCAATTCACTGTCAACTTACTGTTCACCCATACTGACGCTGTCGTAGATGAGGAGTCCACGCACGTCGAGCTCGTTCAGCTCGGCTCGTGTGAGCGT
CTCAAAAGCCCACAGCCTTGAAAACAGGTATGAGTCGTCAGTGGCAGGTTGTCCGCGGAAGACCAGCACGCGTTCGTGGCTGCTAGAGACGCCATGAACA
CTGTAATTTAGAGACCCTATAGACCATTGACACAATATGACAGAATATCACGTGGAGATCAGCGATTCAGACATACACACCGAACATACACTGACACACA
TTGACACACGCACGAACACAAACTTGAAACGATTTCGTCGCATGTGATAGGGCAAATATGTTTAAACTATTTGATTGGCTACTGATCAACTTCTGGCCAA
TCAAGCGGACGGAAACCGTTTGCAATGACAATTTATACACAATTATTTTCGAGAGGGATTCATTTTGACAAATTTCCAGAATCCTCTTATAATATATTCC
CTTCGAAAACAAATAATTTTCGTATTTTTGTAATCATTTCCTCTATGATTACCTTAAGCAATTAATTTATTCATTGATCCAGTTGAGTAATCCAATTTCT
TATTTCTTTCAATCTAATTTCTCATAAATTCTTATTTTTTATAATCCAATTTCTGGTTTATCTTATTTCTTATAAGCTTATAATCTTATAATAGCGGACC
GCCATCCAGTTTACTAAGTATAGTTTTGTACACACGGAATAGCGCAAGTAGTGACCGCCTGCGGTATACACACTTTAAGGGTGCATACTGTATGTATACC
GGTATGACAATTCTAACAATTCTAACTATAATAACTGATGATAAAAACGTAGCTTTCATAAACGATAGCATCGTTTTGTAAGGGGTATGCACTGCTACGT
TATTTTTTCGCTGCGGTATTCGTAATCATCCGAAAGTCCGATAAAAAGTGCGCTTGTATTCGAAGCTGGCTTCTTTTTCTCCGACAAAAGCACGATAATT
GCCCAGCTGCTGCTTCGTGCACCGACATTCGATTAGAGTTTGATAAATAGCGGGTTCACACACGCGCTCTCCCAACGCAAGACCGAGATGATGAGTTCGA
AGAGCCAGTGGCGCGCGACCAGCATCGTCGGGTCGCCGATGCAGCCGCCCGAGACGACCTCGCAGCCCACAGCCACGCCGCTCTCGTCAAAGATGTGGTT
GAAATGCGACCTGATAACAAGCAACACACAGACACACAAGAGGTCAGCTCGGCAGTCCTAGCTAGGTAGCTAAATAGAATATCGATCCAACCACACAACG
CAACGCACCAGTGGAAGACGTCAAAGTAAATCTCGTGCGGCTCGAGTGCCTGCTGCACCTCGGGCGCCGGGATCGACCGGATGCAGAGCGTGAAGCCATC
GGGCGTATGCAGTCGGAAGAGGATGTGCACGGTCAGGAACGTGTACGGCATGCCCGGGTGCACGTGGTCGCGCCGGATGATGTAAATGTCGTCGTTCACA
GTCTGCAAAACCTCGAACTTCATGCGCACGGACGTGTCGAACGAAAGCTTGGCCATCTTGACCTCGTCGCGGAACATGTCCCACGTCTTGAGAAGCAGCT
GCTCGGCGCTCTCGATCGGGTACTTTTTCTGGAAACCGTACTGCAGTGATGAGGTCTCTTGGTCAAACTTGCGCCGGTCGGTCCAGCCCATGAACGATGC
GCCAGTCGAGATGAAGCCGCCACTGTTCACGAACCGGCAGATCGCTTCGTGGCACTCGCGCACAACCACGTAGCACTCTGCGACCGAGAGGTGGTCGAAA
CCCGCGGCGAACGATTTGCTGATCGGGATCCCGTGATCGGGGACTATTTCGGGCAACTCCAAGCTCGCAACCACCTGCTGGAACAGCGCGTGTTCCTGGA
AGAGTCGCCTGAGGTGGCTCTGCTCGTCAGTTAGCGTGCGCACGAGCTCCATAAGCCTCGAAGACATTTGCGTGAGGTCAGTCGTCGAGCGCGGTCTTCT
CGCGGGGCGCACGAGCAAATCGGTTGCGCCGCTTGGCGCTTTCTTCTCGAGCAGATCCGAATACATGTTCTCGAGGCGAGAGACATCGTCTCGCATACGC
CGCAGTAGTCCCTAACAAGAGTGAAAACGTTGAGATGTCAGCATACACACAGTTTGAGCCTCTCGCGCCAATTCAAACTCGACTATGTATGCACAAGCAA
GCGTACCTGCCGCCGCTGTCTGGACTTCTTCTCGATCTCCGACCGCCTCGCGCGCTTCGATGCACCGGAATCAATGGTCGGCATCGCGTCGTCACCGCTG
GTGCTTGTGTTCGACGGGCGATGCACAGCGCCGCCATGGTTCACGCTCCAAGGCTCCTCGTCCGCGTCGCCATCGCGTTCTTCAGGCTTGAATTCGCCCC
AGACTCTGCCAGGGCCGCCTCGCTCCACACTCTCCTCTCTCGTCATTTCCTCATACACGGCAGAGATCGCTTTCTCGACGGGCGCGGGTAGCGGGCCCTC
ATTGACACCGAAAAAGTCGTCGCGCGTGACCATCGCGAGCGTGTCGTGAAAGTCAAAGTGGTCGCCCGTGTCGTCACTCGTGTGGTCGCTGTCCACGCCC
GGCGACGAGGTCGTGAAAGGGGCATCCGCTGGAGAAGGGGCGGCCCATACGCTGAGTAATGACGCGCTCCAGTGTGCAGAAGACACCGCCGCGGCCTGTC
GGCGAGGAGGAAGCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
CTCGTCGCCGCCTTCCATTTCTTCTTGATGGCCCGATGTGTTTGTGATGATGTTCAGATCGGGCTCATATTTTGGGCAAGATGGATGTAGTATAGAGGTT
TAGCAGGGGAGATAAGTATAATAAAGAGGTATTGTGAGTTGCAGTGACAATCACTCTTGTATTTTTTGTGCGCTTGATGCCGCATTTTCAAGACTGCACT
GGACGTGCTCGACGGCCACGACAGATGCGCTGGCGGCCAGCACCGATCTGCTGCACGACGGTCTTCATGCGCAGATCGGGCGCCTCGTCACCACAGGCAC
CACCTCCCGGCTCCCACCGGCAGCGTTGCGTCTCCGTCGAGTGTACCAATTGCCTGCCACCACTGTCTTGCCGCACAGTCTGCGCCAAGCACATCGGGAC
TCCTTGAGCGCTGTATGCATGTGGCTTGCGTGTGAGTATGCATCGGGTGACGAAGAAAGAAGATCACGCCAGCGAGCAGTACTGGATGCCAGGCTTTGAT
GAACGACGAGTGCGGATCCAGCGCTTTGTGAATATTCAACGACGACGTCTCGATCGAAGATACCACTCAGCGAAAGCGGTCAGCTTAGCTATTAGGCGGC
TATCATCACCGAGTATCAGCTTGCACGGTGAGCGAGCAGAGGTGTGCGTGGCTCAAGTGGTTCCCCGCTCATCCAACATGTAGCAAGCCACGCGGGCGAA
CGACGATGTACCTGGTATAAACCCCGCTTACCCGCGTCGGGATGAAGAAGAGGATCCCGACAACCGAGCACGCAAACTTCCACGTCATCGTGCTCCTTTT
TGTAAAGTTGATATGGGATGAGGCTCACAGTATTGATTCCTTTGTGTCTGTTAGGTGTGATCGCCGCTGGCAGAGAAGCGCTGCGTGTGCTGACCCGCTC
GCGTCAGTACCCGGGCGACAGCATGATTGTTGAAGATGTGAACACGACCAAGAACTACGAAGCTGAGAAGAGCGACCATTTTCTGGTTCGTCTCGTCCTG
CAGTCTACACGACGACCTGGGCTCGGTCAACGTCTCGTGCCTCATCGCGCAGCCGTTCAAGAATCAGGCCTCCCTGGACCGGAAC