Description :
From Genome Similarity Track
Location :
Scaffold_2348:1502- 2558
Transcript NameFunction/comments
Phypl_g14985hypothetical protein

Sequence
1056 bases(100 bases per row)
NACCTTCAACAGTAAGAGAAGAGCtagcacctccttctcggccggATGGTAATTCATCTCAGCATCCTTCAATACGCGGCCACAGAACCGGACTGGATAC
AATCGCCTGTCGTGCTCTTACGTCATGGTGGAGCCCAGAACCCACTCATTCGCAAATAGCATGACATGCACGGCCTTGTCTCGGTCGAAATGCCGCAGTA
TTGGTGCGGCCACAACCCTCTGTTGCAGCGCCGTAAAACTCCGCTTGGCTACCGTGAGGTCACCCCCGGGTAGGAAATCTTCGTCTTTCAGCTGGTACAG
AGCAGCTCCATACACAGCAAAGTCCTGGATGAACCGGCTGTAATAGTTGAGCCCCCCAAGAAACAACTGCATCCCCTTCTTCGACGTCGGGAACGGCAGC
TCTGACACGGCCTTGATCTTCCTGGAATCGGCTCGTATACCCTCGGACGACACCTCGTGCGACAGGAAGTCCACCCGTGACTGAACGAAGATGCTCTTCG
TGAAGCTAACACGGATCCGACACTCTGTAAAACCTTGAAGCAGCCGGTCGAGAGTCGCCTGGCTCGTATCAAACGTCTCTGAGCCGAAGCAAATATCATC
CACAAACGATCGTCGATCGAACACAGGCACCAACGAGGATTCGTCGAGCTCGCCATTAGCGAACATGTCCGCAATCGGACTGTTCACGAGCAAGGCGACG
GCATCCATGTTGGTCGGGGACGCTCGGTCGGCTTCGAACTTGGTCGGACAGGCCGGCGTATCGTCACTGAGCATCGGAGAGTCCTCGGTCACCCATGTCC
GAGCAGCATTGGCTTCCTCCTCAGCGGCTCGCATGAGCTCCGAgaagtgtagccatccgCCTTTCGGTTGGACGAAACCCCACAGAGCGTTGTCGATCAT
CCGCTGATAAATCATCGGCGCATTCTTGAGCTCGAATGGCATTCGTAGCCACTCGAAGTGCCCCAGTGCGCACACGAAGGCGGAGGCCTTCCGAGCTCTC
ATGGTCATCATAATGGTCCAGAATCCGCTGGCTGCATCCAAGGAGCAGAACCATAG