Description :
From Genome Similarity Track
Location :
Scaffold_69:150166- 153168
Transcript NameFunction/comments
Hyaar_Emoy2807783leucyl-tRNA synthetase, putative
Hyaar_Emoy2807784H or Na translocating Ftype putative

Sequence
3002 bases(100 bases per row)
GTTCAGCAGTCCGTGAGCACCTTGCTTCTTGGGAGGTACCAAGATCACCTTACGCACGTCTCGACCCTTTACATGGCGTTGCACAGCAGAAGAAGCCAGT
GCCAACGCAAACACCGCGTCCGAGTCCTTTGCCTCCAGCAGAGCAAGATCCACGTCGATCGTGTCCCGCACTTTGCCTTGCACCTGCAACGCTATCTTCA
CCTGGGCCCGATCCAGTTGCTCCGGATCATATACTGGCCACGAGCAAGCATGCACATCGGCAGACTCGTCGTCGTCCTCCAGAGTCTGAAACATCTCAGC
AGCAGTGTGGGGAGCCAGTGGTGCCAACATCTGCACCAGCGCACGCACAGCCTCTTCGTAAGCTGCCGAGCCCTCAAGCTGTGAGCGACAATTGCCAAGT
AAGTTGGAAAGCTTCATCAGCTCTGCGATAGCAACGTTAAACGACTGAAACTCATTCAACGCCTCCGTGACACGCTTGATCGTTCCGTGCAGCTCGTAGC
GCAGCTTCTTCTCGTCTCCATCTACATCATTCGTAGCATTGGCACGGCGACAGACTAGCACGCCATCTATGAGTGACCAAATACGTGCCATCCAGCGCGA
TTGACCTGCGAGGTCCGCTTCATCCCACTCCAGCTCATAAGCAGGTGGTGCCTTGAACAACACAGCAAGGCGCGTGACATCGGCACCGTGACGTGCACGG
ATCTGCTCTGGATCGACACCGTTGTGCTTGGACTTGGACATCTTCTCCCACAGAGTCACTGCAGGAAGCCCAGTCTTCTTCTCCACGACAACCATATGAC
CATCAACTGCTACTTCTTCATATTCGCCCGGTGCTAAGGGACGAAGTGAACCTGGCGACTTGTGCGCCCGTCCCAGCACCATGCCCTGAGCCAACAGCTG
AGCAAAAGGCTCATCGGTGGCTAAAAGCCCTTGATCAAACATGAATTTGGTCAAAAAACGCGAGTAGAGCAGGTGCAATATCGCATGCTCAACGCCACCG
ATGTAGAGATCCACGCCGCTGTGCTTCAGCCAGGTTTGTGCTTTCGCGGGTTCAAAGGCAGCGGCATCGTTGCGGGCGTCACAATAGCGCATGTAGTACC
ATGAGCTGTCGACAAACGTATCGAGGGTGTCGGTGTCGCGCCGAGCATCGCCGCCACAGCGCGGACACTTGCAGTCTTGCCAACCAGGAATACGTGCGAG
AGGTGAGCCGCTACTATGCTTGCCACGCAGGTCGCCAGCCACATCTTCCCCGACAGGCGGCAGAACAACTGGTAGCTGCTCTGTTGGAACCCCGACCGGT
CCACACGAGGGACAATGAATGATCGGCACAGGAGTACCCCAGTAGCGCTGGCGAGAGACCAACCAGTCACGCAAGCGGAATTGGGTAGTGACACCGCCAA
CACCCTGCTCGCGAAGGCGAGCGTTAATGGCCGTCGTTGCTTCCTGTGATGTCATACCGGAGAACTCAGCGCAGTCGTGCAGCACACCATACTCTGTAAA
CACTTCGTCTCCGTTCCGTACAGTACCGTCGGTGCTTCCAACCACAGGGCGCACTTCTAAATCATAGTGACGAGCAAAAGCCAGATCTCGGCTATCGTGT
GCTGGTACGCCCATGACCACGCCGGTGCCGTAATGCGGTAACACGTACTCAGCCAAGTAAATGGGCACATGACGCTTGGTAAGCGGATGACAGGCAAACA
GTCCTGTAAACACTCCCGCCGTTGTATCACCCTTGCCTCGATCAGCTTTACTCATTGCACGTACTTTTGTAACGTAGGCATTGACGGCTGCCTGCTGCGC
TGCCGGGACGTGTGGGAGAAGAGTCTCTACCTCAACACAGTCAGGAGCCATTGAAAGAAAGCTCACACCAAAGATCGTGTCAACTCGCGTCGTAAACACC
ATCAAGCGCATTGGCGTGGCAGCAGCGACCGCCACCGCTCCTTTATTCAGCACGACCTGGAACTCTGCCGTTGAACCCTGCGAGCGTCCGATCCATGCTG
CTTGCATGCGCTTCACCGAGTCTGGCCACTTCTGCAGCTGTGCACGCCGTCCGACAGTGTTAACACCACGTCCACAAGCCTTTTGTCAATGCAGTGGGAC
CCATCGTACCTTGTCGAGGTCCTCCAGCAGTCGGTCGCCATACTCGGTAATGCGCAGGAACCACTGGTTCAACGAGCGCTGCTCGACAATCGCGCCCGAG
CGCCACGACTTTCCTTCGGCGTCCACCTGTTCATTTGCCAGCACAGTCTGATCCACTGGATCCCAGTTCACGAGCGCTTCTTTACGGTACGCCAGCCCTT
TGTCAAACATTTGCAGAAAGAGCCACTGCGTCCACTTGTAGTAGTCGGGCGCACACGTTGTGACCTCACGGTCCCAGTCAAACGACATGCCAAGCGCCTT
GAGCTGCTTCTTCCCCTGTGCAATGTTCGCGACTGTCCAGTCTGCAGGCGACACACCGCGTTCAATCGCCGCGTTCTCAGCGGGCAGTCCGAACGCGTCC
CAGCCCATTGGATGCAGCACGTCGTGACCCTGCATTCGCTTCAGTCTCGCCATACAGTCACTGATCGTGTACACGCGCACGTGGCCGATATGGAGCTGAC
CAGATGGGTACGGGAACATGGCGAGGCAATAGAAGGGCTTCTTCTTCGTCGTCTTCGTTCCCTGCTCCTCCTTCTCGCCCACTGATTTTTCGCACACCTG
GAGCTTCTTCTGTGCCCATTGCTTCTGCCACTTGGCTTCAATGGGCGCCCACGCGCGTACCGGCGCTGCGGCTGACGCCGTCGCGAAGCAGCTGCGCCGC
ACGCGCCAGCGGAACATGACACAAATTCGTGGCTCTCAGCGAATCCTTTCGAAATCGATAAGCAGGTTGGTCGGGTGTACTCACTAGACAGTTTAAGAGC
ATAGTGTCACTTTTCTGTGCCAAAGATATTTGTGCTTTTTAATTCGTACAGAAACGGTCGTGTGAAGGGCGTCTAGGTATAACTAGATCAAATGGTCGGC
GC