Description :
From Genome Similarity Track
Location :
Scaffold_20:1501571- 1502617
Sequence
1046 bases(100 bases per row)
AACCCTGCAGCTGTCTTCTTCTTCGTTGTGTACATCTGCTTCAGCGCTAACATGGCCGAAATCACCGATGATGTATGTAACCAAAGATTTCGCGGTAGTC
CATAAGTGAACAGCCCAGACACCACTCAGGATCCAGACGAATTTGTCCCAGCGTCATATGTCTTATTGCATTTTGGTACTCCAGCTACGATGACAAAAGC
TATTAGAAGTGGTCTCACCCGATACAATCCAGTTCCGGTATTCTGATAATACCCTTACCTTTGTAATATCACAACAGTCAGTAAACGGCGAAACCACATC
CTCGATTTGCCACTCAGCGCCTTCGATCCAATCCAGAGTGAGCTGCACAAGCTGGAATCGATTGCGTGCCTCTTGAACATTCGCCAGGGCTTCTAGCTGA
CCAAACGTCGCGAAGCCAAAGTCATGCCAGTGCGCAAGCAGATTCAAATTGTCAGTCGCCTTGATCGACTGAATCGCCTCGTAAAGCTTGTTCAGCTGAG
GGATCGCACAAATCTGGGGTACTTGCTGACCGACATTGAACGGTCTCACTGTAAGACTACCTTGCACTTCAACATCCAAGAGATCTAGCGCGTCAATCAC
TGCCTTTGCGAGGTCGAGACTGTAAGCTTGTTCCAGTAAAAACAGCGGCATCATCCAGTCTGATCTTGCACTTCTTCTTACCGCCTTTAAGCTTCATCAC
CAGTTCCCGCGCCGCCGTGAGCTCTTTTCTGCCTGCTAAACGGAGTTTCTCACGTTTCGAGGGCCCGCTAACGCGTGGAGGTGATGCAAATGAAATCGGG
GCTTCTGCAGACCCATCTATGGGCTCGAATTGTGCATTTTCTGTATTTTCCGGTGCGAATACGGTACCACAAGAAGACGAATCGGGTACAGTTGGTTCCG
CCAAATCCACAGTTGTTTGAACTGAAGGCTCGCAAACGACTGCTCCTAAAAACCGCATTCTTTTCCTCCAGTTGATCGACATCTTCTTTCGCTTCAGTCG
TCGCGGTGGTAGTAGAAGACGGTTGTACAAATAAAATTTGAGTCAG