Description :
From Genome Similarity Track
Location :
Scaffold_65:150102- 154999
Transcript NameFunction/comments
Phyca_LT1534126858TonB-dependent receptor

Sequence
4897 bases(100 bases per row)
acaaactctgacaacggggacctcttgtttgtccaattcgagtctccagcattatccgaaaaagcttctccaaatttcttatcattcgatggagggggca
cctcatgctccaactgccaagacatattttcttgaatgggtcgaggcttctttctcgattgccctacagtttgtgcatcattcgtgaaagatgatggtgt
tcgacgtcgaactgcgaggtatcgccagtgtcttgcaatggcagcaaccctgcgccaaacttgtgctgtgttgctcgcctgagtacgtgcgacttgctgc
tcgcgctgctcctgcaaatgtagtgcagcggtcatccagtgtcgtaaaccatcgcgcaaaaactgctcgtgacgaaactcgagggcttcgtggtagcgtt
gttgctttgtcctttggaattcaagtactgtttccaaccggtaaatgccttgcactccagcgtcaatttccagtgaaccagcgccactcgaaccttttcg
cggtagcgctggcgcagagctacattgccgcgccagcgttcgaagcatttcttccaaagtacagctttataatgttgttccgcccgagcttgcgttattt
gcttccatcgtagaaccgaaacaaacgtaacccaacgcgaaaaggaggtctgcagtgttcgctgttgtgctcgacctctcacctgagcatttacgaccct
tttggcggctctatcgcgggcaaactccagccaattttcgaacactcgggctttaatggctagatctttttctttcaaatgttctcccagtgtttgttcc
cgaacttgatcgcggctacgctcagattgccacaatgctttccacatgtaaaagcttttacttactgcccgggcataattgtgttcgcgcgcagtagcca
acatagttttctttaataatgcgccggtatagaaggaccggaatccctttgaccacacccgtttcagcaattgtgcttcgtagtgcagtactgcgcgttc
tgccttgtgagcttgcaatttcctttcacttgtgaaatggtcccatcgtgaaaatgccaacgccatcgttctatgatctgctgcgtcttgcataatgtcc
acacgatctaacgaaaggcgtcgctgggttaggcctacttgaaacgcgctaaaccctttacgtagcagtgataagtagtgctgacgcacagcgcgacgtc
ttcgctgttcttgcagttgcttttctctactccgagcactccatgcattccatattcggcgcaatcgacgttcctgataaccttgagtaaagccctcaag
cttgataatctggtccaccgttgttttccatgttttccacgctctttcacaaactttccgatacaaatagcggtctagaagatgcacaagagccctttgt
ccgtgatgtcgagcgtgttgtttctcccaaatattaaacgcgagctggagtaaacggcggtgggtcatacgggtcaattcttcaaccatagggccgtaaa
gcaacgcctcatggcgtcttcgtcgcacataactcctccacaaacacagcgtttgctgcaattgtaatcgcagccgccactgctgcattgctttcaccat
taaacgcagccgattcgcttttccaatcttgactgtcaacgcacgctctttcttcttgagcagtgcgtatcgaccaagttgattcaacgaccgcttaagc
agccagtagtacaaaaagaagtacgctcgttgctgcaggacatcgcgatcctttttcaaccgtacaaaccctctccagcgtcggatggcatgcaaccggc
ggatccgtacgaccacagcgtcgtgttcagcgtcattagacttctccttatgcaaaaacagcctttgctagacaagcagttagttaaccgaaagtaaaac
ctgaatgtgactacatctctccctcacccaaactgcagaattgtcatcgttgtttccatcttcggggcctgcctctagtgctttcccttctttgctgtct
tggacaatttcagtatcattggtcgtattgtttgaggcagtcatttcttgtcgttttagcgttacaaaagctctccatttctcccagaaaatccgctggt
aaaacacagcacccactctacaagctgctgcgacgcgctaggtaaaagaacgggaataacataaatagttggtccaagaaattgccgagactaattcgta
cttttctccgcacgcactgcacctgagcgtgtcgtttccatgatttaaatacgcgctgaagctgcctgtgtcgatcgtgatggacagctagtaccacgtg
cggggatgaaggcgctatagcgatttctaggctggtattcttcgcgccttcaggcaacgccattatgatcgtgctggttttggattggctgaaattcgat
ttttggataagtttttttgtaactggaatgagtcatccgcaaacgcgctgtaaagttatggatctcgtcctgcaagaggcaaatgtgtgtctaaaacgag
aagggcaacaataccggtatcagttgtggaaggctgcgctattttaatagcatttaggtgacagaagttcttgtcctgttctgactactccttcgagcgc
tcaagcattcgagaaactcgtggtaaggtcagcaattgatgccatgcgaaccgccgattctaggcaagcaagaacgcagtcgaagcgtctcagtggcctc
tttcatacctatgaagaagccactcaagaattccgagcggagacctcaaagccgatcacagcaaacagaccgccatccgccttgaaatccacgggtcacc
gtttaattcacgacgacctgatttcaacagagccgaacgaatcgccgaaggtttcccctagggatgcaactagcagaacacctccagctcggctcagtgg
gggatttccagcacacgataatgagttgatgttaaacaacgatgagctctcgatgatgacttccaggatgagcaacccaacactgcccttgcagatttgc
actcgtccacctcaagatgctggatcattcacaaacaagctggagtcgccatccaggtatgccagtggatccagtcggccttcgtcagctgccaagcgta
gcgggcttctccaacttcacgatggtggaatatctatcagcactcaagagatcatggccgtaacacctcgcaaaagtctgtcatctaccccagtcaacga
gacgaaggataatccccatgtccagagtaacgagacaccgactccaaagcctgcattgccaccgagaaatgttccgctttcacctattcggcagcttagc
gaacgcattaaagtgcatgatgacggcgcacttcctatcagaacagaggtctctccaaaaggggccatcccagttttaccaattcgacaaccaagtaggc
gtctactagttaatggcgatggaaatatcgcaatcaggagggattcagccgttatgacgccgatagtggctgtggcgatgacctctgaggtggttgatac
ctggaaatcaaccgatcgaaattctaaagagcctctggatcatcaactcgatggaagtcgtcgctctgaaagcaatgatgaacatggcgccgatattcct
gacatttcatcgtcaatagctacagaaccagaaccccacactcccatttcgcgattcgcaccactacacagtcaatggacctacggccagcggatttttg
gacgatacaagaagacaccgtacttctactcgggtaatattgccacctatctaggtgcaggaatgttcatggtcgtatttgacgatggaacactagatta
tcgtgttcgtcgcgaagatattatgctgcgagagcacagaaaacatcgtcaagatgaagaaaaatctttacagaggtcgggcagtggatcgtttcaccgc
gacagctttcaaatgaaagcagaagatgacagtaactcgaagtcccgaaggaagtcgcagcaaaagctaggtgaagagagtgaagagcaatgtctagacc
cgtcgatggcaccggagatgcatctaccacccttacaacacctgatggtggatttctccgtcaccccaccaaaagaaatggtgctgagctttgatgatag
tggagtcgcttacgacgttgggctgccagcttgcggcgccacacatgtggagaatgagacttggcgccttctcttagatgatgaaaccctgacaatgaaa
cgactggagtgtggggtgggctacgaggatgactcaactcaagtcagtgactcaggtgaatcgagcgaagacgatatgatgatgacaccttggcagcaaa
tgacacagacgttcggaatggggaaagctgctcgaccccagcggggtaatgggcggcgatcaagcatttcatccgtttcccaggtcgaccgcctatcagt
gacgcaaaagagcatgaagcagatcataccaacccccaggagcctcaaacaagttatcaccgagtacttcctgcgtggaaacaaaaaggttcagccctcg
aaacccacagaagaactcgctttggctgagcatatccggttgatggaagcaaaactgaacatgatgcgatcaactcggtgcaatgcaggccctcctctaa
agcgaggagattgtgataaccttcgtgttgtctacgaacggtcccccgaagggattcgtgcttacggcacagtctcaaaacgagtggaagatggcagcta
cgctgtcgttactgaagacgaacacggtatttcagcgcagatggtacctcaagatatggtggacttcttgccgtctgtaaatgaactggaacagcaactg
acagacctcgagcgaacacaacgtgtcttctttgctggacaaagggtccaagtatcgctgtatcctggcagtcgcttctccggtcgtgggcttatta