Description :
From Genome Similarity Track
Location :
Scaffold_91:1501- 3296
Transcript NameFunction/comments
Phyag_g1892hypothetical protein PHYSODRAFT_476587
Phyag_g1893hypothetical protein

Sequence
1795 bases(100 bases per row)
GGCAACTCGACGTTCAGCATCGACATGGTAGGCATGTAAACTCTGAACTCCCGTTTTGTATGTTGAATACGTCTCGATTCTCACCTCAACACTCCTGGTT
GGTTGCAGTATAAAGCAGGCTTCCACAACATCACAAACATCGACTTCTCCAAGGTTGTCATCGAGCGCATGAGCGCCAAGTACAGTGTACGTGCCAGAGA
CCAATTGGTTTGTGTCCCACCTCCTAGACACTAACTGCTgactgcaggacgagatgcCCGAGATGAAATGGCTTGAGGCGGACATGACCAAGTTGCGTGA
TGTTTTCACGAACGAGAGCTTCGACGTGGTCATCGACAAGGCCGCCATGGACGCGCTCATGTgcgacgaaggtgacgtCTGGTCGCCTTCGGAGGCTGTG
ATCGCGCAGGCCGCCGCCATGTGCAGCGGCATCACATCCGTGCTGGTGCCGCAAGGAACCTTCCTCCAGATCTCGTTCGCGCAGCCGCACTTCCGCAGGC
GCTTCCTGCTGGGCGAGGGCGAGCAGGCGCCCACCAGCACAGTTTACGGCTGGGACTACTCCTACCACAACATCAGTGCGTCGCAGCTACTGCCATCTTC
GCAATTGATACGAGCTAGAGCTAATTTCCCTCTTGTACGCAGACATTGGCTTGGGCTACTTTTTctacgtgctgcagaagagcaAGACCAGCACTCAATa
gacgcagcaacacccCAGCCACCATTCAATAGAAACTGCATTTGATTCCCATGGAGGACTTCTCGCCGCGGCCTGGTGCCATGAACGCAGGTTTTCTAGT
GTATTCGAAGCTTGAACGGAATGAAAACTGTGGTAGCATTGACGTACATCTGCCTTTGTGGTATGAAATGTTTGCTCCTTTTCTCAACCGACGCCGCGCA
AAATAGCGTGATCATTTCGGGCCGGAAATAGATTCAAAAGATCCCACCAGCTCATTCGCAATTTTTCTGGGAACACAGCGCGCGCAATGGAGCACTCACA
CGACCACAGCCACAGTCATGACCACAGCCACAGTCATGACCACAGCCACGCACACGAGCACCTCGCTGACGGGGACGAGGTGGTGCGCCGCTTCACGCAG
AGCCGCGGCCGGGCACCCACGcccgacgaggagaagcagctaCGCGAGCACGGCCACACGCACGAGCACATGGAGCACGCGGGGGAGTTCCACGAGCGCG
ACGTAGCCAAGTCTGGCCGAGACTGGACGCAGCGAGCCTTCACCGTCGGCATCGGTGGTCCCGTGGGCAGCGGCAAGACGGCGCTCATGCTGGCGCTGTG
TCGCGCGCTCAAGGGCAAGTTCAGTTTGGCCGCTGTGACCAACGATATCTTCACAcgcgaggacggcgagttcCTCGTGCGCCACGACGCGCTGCCGGAG
GAGCGTATCCGGGCCATTGAGACGGGCGGCTGCCCGCACGCGGCGATCCGCGAGGATATCTCGGCCAATCTGCAAGCCTGCGAGGACCTGACTGACGAGT
TCGacacgcagctgctgctggtggagtcCGGAGGAGGTGCgtgggctgctgcaggtgcctTGCTCAGAGGTGCATGCAGTTGATGATATGTGCGTGATCT
ACGTGTGCGTGTTTGCTAGACAACCTGGCGGCCAACTTCAGCCGCGAGCTGGCCGACTACATTATCTACGTCATCGATGTGGCTGGAGGCGACAAGGTGC
CTCGCAAGGGTGGCCCCGGCATCACGCAGGCGGATCTGCTGGTCATCAACAAGATCGACCTGGCCCCTTACGTCGGCGCGGACTTGGACGTCATG