Description :
From Genome Similarity Track
Location :
Scaffold_2276:1501- 3107
Sequence
1606 bases(100 bases per row)
CTCCCAGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCGGATGTCCACTGCG
GACCATCCGCAGACAGACGGCCAAACAAAGCGTGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGC
AGCTTCCAGTTGTTGTGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACACCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCT
CACTCTTAGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGG
AAACCGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACA
AACAAGCAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACAAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAA
CAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACACACCCGACG
TTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGTCTCCCCCTTGACCCAGCTCCTCGGAGCGAGGGCCGGGCACCA
GTCGTCGACGAGGGCCTCCGGAGCAGGCACCCATACCTCGGTCGGGACGGCAAGGCTGCGCCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCC
CCGCGCCATACGCCGAGTACGCTGAGTACGCCGGGCACGCACCATACGCGTACGTCTGGGAGTGTGCCGCACGCGGCTCCGGACGTGGCAACAAAGCCTC
GATCCGTCGGATCATTCGAAAGGCCTCATCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCC
AGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTTTCAAGGCCAAGTGCAATTTCAAGCACGAGGACAC
GTTGACGGAGGCGGTCAGCCTCAGGGTCCTGCGTCGGACCCGCACTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTA
CGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTAGCGGTAAGCGACAGCTCCT
CGTGAAGTGGAGGGGTTATGCCCACTTCGAGAACTTGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAG
CGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGC
GCGCTT