Description :
From Genome Similarity Track
Location :
Scaffold_78:150065- 151873
Sequence
790 bases(100 bases per row)
TGCAGCGGCGTTTTGATTGGTGACTTTTCAGCCAATGGCATTGACGCAATCAAGATCATGCGTCGACTGGCATGGCTGCCACCCAGTCCTCCCTACCATG
TCCTACGACAACAGCGATGAACCAGTGTTGCTGCATACTTGAGCTCCACCACACACGATACGTCTCCTCACAGTAGAGGAAGACGTTCAAGCACATTGCC
GCCGTTGGAGAGGACAATGCCTTAGTACATGTATCGAGACCTGGACATTGTGCAAGTCTACCGAGAAAGCACGTCGGAGCGAGCTAGCTGCAGCCACCTT
CTGCACCAGAGTCTCAACAGACGCTGCAGACTCGATCGGCCACGCAAAGTGTCCAGAGAGCACCCACGAAGTCGCATCATCAGGCGACCCAAGTTCCAGG
ATGGCGCAGAAACTGGTCCACCGTCTCGGAATATGTAGCAATTGCATGGCTGGTGCCAACGCGTGCACTAACAAGCGCCGAACAGTGAGTTGCATCCAGG
CAACAAAGGACGGTGTTTTCTCGTGTCGACTGTGGAGGCTCCTTCTGCAGGAAGTTGCTTCGACTACACTTTCCTACCTTCCTACTCGGTGTCTTGGCTC
ATGGCGAAAACAATGGCTCATGGCCCAAGATTCCGCCACGTCATGGAAGTGGCCTGACGACAAAGTGCAGTGCCCGCCAAGTTGAAGTCGGTGTCCAGTC
AAATCAGTCAGTTTTAAAACCGACCTCTCGAAATTAATACCCCAAATTCTATTTTGAGAGGAACATATCTTTGTGAGCGGCTCACTTTCA