Description :
From Genome Similarity Track
Location :
Scaffold_14:150013- 152678
Transcript NameFunction/comments
Aphas_H257_06132S-layer-like domain-containing protein

Sequence
2665 bases(100 bases per row)
CCTTCCGCGTACAGCATGTCCACACTGCCGTCCACAGATAAGAGAGTAACTGTCCAAGAAAACGCATTGTTAGGACCTGCCACGGGCGTCGCAACGTTCA
CGGCGTAAATGTCTGGCAGTTGTTGCAATGCAGCGGTGAGCGCAGTCGACGTAATGCCAAATGGCAAGTCAGGAGTCTTAGCATTGTGAAAGGTCAATGT
GAATGTGCCCCCAATGGCGGAACGGGCGGTCGTTGAAATAATTTGGGTTTGGTGGACTTGACACGACGTCACCGTGGCTGTAGCCGTGCCTGTGCCACCG
GTGACCGTCAGTTGCGACGTGTCTACGCCAAGAGAGGGCAAATCCCCCACATTCGAGTCAAATGTGACAATGTACATGAACCCCACGGCGGATTGTTTGT
ATACACTTGTCGATGTGCTGGTCGCTCCGAGATAGGGGGACGACAGCAGGATGTTTGTCGTGGATATGCTCACGACCGTAAACACTGGTCCAGATGTCGA
GCCGAGGCGAATCCAGTCCCCCACTTGGAACGATGCCGTCAAATCTGGCGTCGTTAATGTGTCGGAAAGATATGTAGCACTTACAGTGTTGACCAGCGTT
TGAACCGAGTTGGTCGAGACAACCACGTCGCCAATGGAGCTCAATTTGTCCAACGCTGACTGAACCACGTTGATGCCAGCGTTCCATGCTAGGGCAGGTG
TAGACACCCCCTCGTAGCTGATGGTAAACGTACCCCCCAACACCCCAAGACCATTGCCCGATTGAATGTAAGTTTCGACTATTTGCACTTCGGGATGGGG
GGTGCGAATGTTGATCAGATTGCCGTGAATGTCGCGCGGTTGGATGACAAACGTCGACATTGAGTTGTACGCACCGGTAGACAGCCCATTCTTGCCCACT
GTGCTCATGGACCCCGGCCAGAATTGCACGGCGGAATCCACGGCTGTGGTCTGATTGGCTACCAGGGTCCCCGGATCGACAAACGCCACGAAGGGGGAGG
ACCCCGCGATTGTTGTGATACCATTCGGCGACACAGCGCCATCTGCATACACCAACGCGCGAGGGCTTAGGCCGCCGGTCAGCCCCACCGCAGTCACTGT
CATGGCCGGAAGGTTTCCAAGCATCCGAGTCGATTGGATGTATTGCGCCTCAAGGTACCGCGCCGAGGACCAGAACTTGGTCTGAGACACACCGGCCAGC
GACCCCATGAACGTAACGACCCACTCAAGGCCAAATGGGGTGGTGGAGGAAGTGACGGAGACCACAATAGACGCATCGCCCAAGAGTTGCTGCAGGGCAA
TTTGCACTACTCCCGTGTTGGCATTATACGGCAATAGACCAGTCGTTAAGCCATTCCACGTCACTTGGAAGCTTCCAGCCGTCACCGCGGTCCCTCCGCC
CGACTCAACGCGAAGGACTTGCACTTCATTCACCATGGCTTGACCCAAGTTGGACGAAGTTTTGATATGCGATTTCGTGCCGTCTTGAATCGTGGCCACT
GCGCACGCTGAACTGAACACTAGGTCGTTGTTCACGACCAACGGGGGAACGTCTCCAACGTCCGAAACAAACGTGATGCGGTGCACGAACCCGTTGTTGA
CTGCGGTGCGGGACACTGTGACCGGGTTCGAGTGGATGGCCAACAGTGCACTGGCCACTTCGTCCGACGTCGAGTCCCACGCTAGTGGAATCGTCGTGTT
GGCGGCAGCGATCGTCAGACTGAAAGTCCCAGCTTGTTGCGTGCTCGATGTAAAGTCCAGCGTCAGCGTTTGAATCTCTGGCAGCATCGCCATTGCCACC
ACCATGGTGTTGGCACCAGACAGATATGGGGCGTAGCTTACGTTGTACAGCCCGTTGCCTGCATAAGTCACCTGCCCTTGTACAATGGCGGTGTCCGTGT
ATTGGGTGCCAGAAGGAACGACGCGCACATCAAAGTAGTCCTTTGGATCCGAGTCTTCCTTGTTGTTGCCGTGGGTGTCCTTGGCTTGGATCGAAAACGA
CGACGTGTTGCCTGCGATAGCGTACACGAGGCCTTGTCCAAATGCCGTCGTGACTGCGGGATTCGTCGCCGCTGGACGCACCACCAGAGTGGATGGGAAT
CCACTCAAATGTTGCCGCGCAGCCCCCGCTCGTAAGCGGGCCACAGTCACAGTTGCCGAGTTCCCAGTCAGTGACTTTGTATACTGGGGACTTAGCAAGT
CGAGAGAACCTTCGTCAGGGCTACGATCAAACGTAATAGTCCACGTACACCCAAGCGTCGGGTCGTTTCCAGTGCAAACAGCAGGCGCAACGGTAGTGCT
CCCGACAGGAATGTTGGCACACCCTTCCAATGCGGCTTTCACCGCCGCAGCATTCGCGTTGAATGCGATGGCTGCAGTTGTGGTCGTCGCTTGCTGGCCG
GTTGATTGCCATCCCTTGAAAGTCAAAGTGAACGACCCACCCAAAGCCGTCGAGGCAGCGGTGGTGACAGTTTGCACTTCGCGGATTTTGGGAATCGCAA
CGTCCAACACGTACGTTCCTTTGACTTGCGGGACAAAATTCACCAAATACTTGCCCGTGTTGACCCCAGCTTTGAACACTCGGACAAACTGGGCGTCGAC
TCCAGTGTACGACGTTGACATTGGAACTTGCAGGTTATCAAACGTCCCCAAGACTGTATCGACGG