Description :
From Genome Similarity Track
Location :
Scaffold_69:150012- 152511
Transcript NameFunction/comments
Hyaar_Emoy2807783leucyl-tRNA synthetase, putative

Sequence
2499 bases(100 bases per row)
CCTGCTTCTCTCACGGTTCAGAGACCTCCACTGCGTCACACTTTGTCCATCTGTCCTGTTGTCATAGCCCTAGAGAAGTCATGAGAATGCTGAACCGGCT
TGTACGCTCACAATAGTCTATTCGTGAGCAATAACGCGTCTACTTCACCACAATGTTCAGCAGTCCGTGAGCACCTTGCTTCTTGGGAGGTACCAAGATC
ACCTTACGCACGTCTCGACCCTTTACATGGCGTTGCACAGCAGAAGAAGCCAGTGCCAACGCAAACACCGCGTCCGAGTCCTTTGCCTCCAGCAGAGCAA
GATCCACGTCGATCGTGTCCCGCACTTTGCCTTGCACCTGCAACGCTATCTTCACCTGGGCCCGATCCAGTTGCTCCGGATCATATACTGGCCACGAGCA
AGCATGCACATCGGCAGACTCGTCGTCGTCCTCCAGAGTCTGAAACATCTCAGCAGCAGTGTGGGGAGCCAGTGGTGCCAACATCTGCACCAGCGCACGC
ACAGCCTCTTCGTAAGCTGCCGAGCCCTCAAGCTGTGAGCGACAATTGCCAAGTAAGTTGGAAAGCTTCATCAGCTCTGCGATAGCAACGTTAAACGACT
GAAACTCATTCAACGCCTCCGTGACACGCTTGATCGTTCCGTGCAGCTCGTAGCGCAGCTTCTTCTCGTCTCCATCTACATCATTCGTAGCATTGGCACG
GCGACAGACTAGCACGCCATCTATGAGTGACCAAATACGTGCCATCCAGCGCGATTGACCTGCGAGGTCCGCTTCATCCCACTCCAGCTCATAAGCAGGT
GGTGCCTTGAACAACACAGCAAGGCGCGTGACATCGGCACCGTGACGTGCACGGATCTGCTCTGGATCGACACCGTTGTGCTTGGACTTGGACATCTTCT
CCCACAGAGTCACTGCAGGAAGCCCAGTCTTCTTCTCCACGACAACCATATGACCATCAACTGCTACTTCTTCATATTCGCCCGGTGCTAAGGGACGAAG
TGAACCTGGCGACTTGTGCGCCCGTCCCAGCACCATGCCCTGAGCCAACAGCTGAGCAAAAGGCTCATCGGTGGCTAAAAGCCCTTGATCAAACATGAAT
TTGGTCAAAAAACGCGAGTAGAGCAGGTGCAATATCGCATGCTCAACGCCACCGATGTAGAGATCCACGCCGCTGTGCTTCAGCCAGGTTTGTGCTTTCG
CGGGTTCAAAGGCAGCGGCATCGTTGCGGGCGTCACAATAGCGCATGTAGTACCATGAGCTGTCGACAAACGTATCGAGGGTGTCGGTGTCGCGCCGAGC
ATCGCCGCCACAGCGCGGACACTTGCAGTCTTGCCAACCAGGAATACGTGCGAGAGGTGAGCCGCTACTATGCTTGCCACGCAGGTCGCCAGCCACATCT
TCCCCGACAGGCGGCAGAACAACTGGTAGCTGCTCTGTTGGAACCCCGACCGGTCCACACGAGGGACAATGAATGATCGGCACAGGAGTACCCCAGTAGC
GCTGGCGAGAGACCAACCAGTCACGCAAGCGGAATTGGGTAGTGACACCGCCAACACCCTGCTCGCGAAGGCGAGCGTTAATGGCCGTCGTTGCTTCCTG
TGATGTCATACCGGAGAACTCAGCGCAGTCGTGCAGCACACCATACTCTGTAAACACTTCGTCTCCGTTCCGTACAGTACCGTCGGTGCTTCCAACCACA
GGGCGCACTTCTAAATCATAGTGACGAGCAAAAGCCAGATCTCGGCTATCGTGTGCTGGTACGCCCATGACCACGCCGGTGCCGTAATGCGGTAACACGT
ACTCAGCCAAGTAAATGGGCACATGACGCTTGGTAAGCGGATGACAGGCAAACAGTCCTGTAAACACTCCCGCCGTTGTATCACCCTTGCCTCGATCAGC
TTTACTCATTGCACGTACTTTTGTAACGTAGGCATTGACGGCTGCCTGCTGCGCTGCCGGGACGTGTGGGAGAAGAGTCTCTACCTCAACACAGTCAGGA
GCCATTGAAAGAAAGCTCACACCAAAGATCGTGTCAACTCGCGTCGTAAACACCATCAAGCGCATTGGCGTGGCAGCAGCGACCGCCACCGCTCCTTTAT
TCAGCACGACCTGGAACTCTGCCGTTGAACCCTGCGAGCGTCCGATCCATGCTGCTTGCATGCGCTTCACCGAGTCTGGCCACTTCTGCAGCTGTGCACG
CCGTCCGACAGTGTTAACACCACGTCCACAAGCCTTTTGTCAATGCAGTGGGACCCATCGTACCTTGTCGAGGTCCTCCAGCAGTCGGTCGCCATACTCG
GTAATGCGCAGGAACCACTGGTTCAACGAGCGCTGCTCGACAATCGCGCCCGAGCGCCACGACTTTCCTTCGGCGTCCACCTGTTCATTTGCCAGCACAG
TCTGATCCACTGGATCCCAGTTCACGAGCGCTTCTTTACGGTACGCCAGCCCTTTGTCAAACATTTGCAGAAAGAGCCACTGCGTCCACTTGTAGTAGT