Description :
From Genome Similarity Track
Location :
scaffold_7:150- 5962
Transcript NameFunction/comments
Pl_112685conserved hypothetical protein
Pl_112686hypothetical protein PHYSODRAFT_505751
Pl_112687conserved hypothetical protein

Sequence
5812 bases(100 bases per row)
CATGCCAGAGGAGACTGTGGTGGGCACGCGGCTGCATTGGCATAGCCACTCGCAGCACGACCGCATTGACGTCGACAAAGTACTTGGTCAAGTTCGTACA
TTCTGCACTCGCGCGGCCACATACTCCAATGGTGGAATTCTCATTGCAGTGGGGCTTCCGGAAGCGATTGCAGGGTCGATCTCAACCGCTCCTTCATCGG
ACGGAGAGTCACCCTCGTCCAGTGCCTTCCTGGACTCAGTGCGCGAGTTCATGACCCAATTCCATAGCGAAGTGGCTGCAGGAACCCTCCCCGGTAAGGT
GGAGATCATTCCGATGCTTCATTGGGGGAAGTTTGTGCCGGCCTTGAATGCTTTAATCGGCACGGCAGCCGACCGCTTCCCCAATGCTGACACACTGATC
TTGCAGTCCCTTGAGATTGACGTGGATGCAGCTAGTGTGGAATCTCTGCGCTCGCACTTCGATATTAAGCGAGACCTTGTGGTGGGTGCAGCGCTGCCTG
GTCACGACTTCCAACCGGAGCCAACAAGCCAACCCGTCGAGTTGAGCGGCTTGACATCGCCGTGGAACACACTAGCGCTTTGGAACCTGGAGCAATTGAC
GAAAGTGGGGTTTGCTCTTATGGGAGACGCGTTACGTCTAGAAGTTGACGGTATTGGCTCTGCAGCTGGCATCGAAGAGGTTGCTACAATCACCATGTAC
CAACAGCTCTACGCGAACAGTACATTACCTACAACGGCCAAGTTGGTGCGAGTGCCGAGCATCGCGTGGCAAGTGGACGGACTAGAAGACCCCAAGCGTC
TCGCCTGGCATGAGAAGAAGATGACTAGCAAACAGCAACGTGCAGCTGCGCAGCTTGCCAACTTTGGCGTGGCACCTGGCTGCGTGTACCATTTGAACGC
GTGAAGCAGGAAAGTTAGTAGGACTGAACATCAGAAAACGAGATCTCGGTCATACTGAGTGTGGAATAATGTGAATACCAGCGCTGCAAAACTAAGTGAT
CACAGATGCAATTGCTGAATAGATGGAGATCATCCCTATGCTTTACTGGAGCAAGTACGTGTCAGCATTAATAACCTTGATTGAAGTTGCAGCCTACCCA
CACGCTGACACTTTGCAGTCCTTGGAGATCGAAGTTGCTGCGTTCAAATCTCGTTCTACAGTATGAACGCCTGGCCGGGAAGAGCAAACCGCGCAGTGTC
GCACCCGGCTGCGTACATCATTTGGATCCATGAAGCTAGATGAGTTGGGAATGTGGTAGAACAGCTACCAGGAGTATTACGACTCGTGATTTACGAGCAC
ATTCCAATGTCATTCCTTGGCTCGTTTTGCTTAGTACACTGGCGGACATTATCCAGACATTTACGGTACTGCGAGCGTCCTCTTGAAGCCGAAGGCTCCA
GTCTCAAACACGACGTTACGCACGCGGACGGCGAATGAGCTCAGGCGATGGTATCCACGCGCGCGCAGCCTCTCTGCGTAAGGAAGCGACACGACGATGG
CTCGTGAAAGATGAGCTGGTGTTTCTATTGCTGCAGTACAAACTGGTGGGCGTTCCAGTGCTTCAGTCGCTGCAGCTACGGCCGCCAAGTACGTCTTAAT
GTCGCGAGGTTGTGTTCTTGCAGAATTAACCGTCTTCTGCTGCATTAATAGGCGGCACTTTGTTGTTCTACAACACACTGAAGGTCTCAGACTACAAGAA
GGATGGGTGGCATTGGCAGAAACGCAAGGACAAGAGCGGACGCGTGCGTGAGGACCGCGCCAAGCTCGTGATCAATCGAGAAGTGATCATTCTAGGAACA
TACGTTCATTCTGCTGAGACTTCGGTACGTTGGATAGAGGTCATTTACTTCTTGGTTGTTGGTAGTGACATGTTGTGGTTGCAGACGTTTCATCGGAGAA
TTTACTCGGTGCGCGATTCCAAGGAGAGCATCATACTTGTTCACTACTTCGACGAGATGAATAAGGAGTCTGTGCCACGTCAATTAGCGGCTGAGAAAAA
TGAAAACACGAACAAAGGGCTAAAGCGGGCACTTCCCGTTGCCAAGACAAGTGATGCTTCCACAGGTGTTATGCTGTCATTTCATCAACCAAGCCCATCG
AAGCCTGTGTCATCGGATGAGATGGTTGAATCCATTATGAAAAGTATGCAGGTGATCTTGTTCACATTCGTCGTACCAGACTTTTCTGATTTTATAACTT
GTGTTGTCTCCATTTGTTCAGATTGTTTCGAGATGGACTTTGAGCCCCACGCGGCATCATATCAGACTTCACTTCACTAAATATCTCCGACGAGGATCTG
GTGCTGTTGAAGGACAATGCTATGGATGGAATCACTACTGGTTTCGGTATGGACGACCTGTTTAATGATTTGTCTTGTGCGATACCACCGGAAAAAGATG
TCTGCGGCTTAGGAGGCCAACAGACTTTTGAACTAGCTGAAATCTCTGATTTTTCACCGGACTGGGATTTTGGTGATGGTGGCGCCAAGATTCTAATCTG
CCTGGCAGCAAAGCTTTCCGAAAGACTGGCCCAAGATTCTATGAAACTATTTGTGCAGTTTGGTACCATGAGAGTTCGCGCGGAGAAAGTATCGGACACA
GTACTGCGTTGCACTGGTGCGTCTACATTGCATGCATATTTATTGGCTAATGGCGTTGCTGTCTCATATAGCTGGTACTCACCGCTTCTCTATTGCGTGC
ACTTTTACTGCAGCTCCTAGTTCACGAGAACTTGGACGTGTTGACATGTACGTGTGTCATTGGAGTGGGTCACTACAACAGGAGAGTATACAGATGTCCC
ACAGAAAGCAGTTCACGTATCGGAGTCATTACCAGGTGTTCCCTTCTCTTGCTGGTGAAATTGAAAAGGAGAGATGTCTTTCCGAAGCAGACACAGGAAC
AATTGATCCATTGGAGCTTACTGCATCATATCCGGTGCATGGTGGGTTTGGTACTGGCAAGCGAGGGCGATCACCAACTGTTCTATCACATCCTATTGAC
GTCAAACGATTAGATGACAGAGCTACTGGACCAAACAGAAATCTATCGACATACGTCGAGTCGGATTGTAAGATTCATAGTTGCTGCTTCGATTCGTACC
TTCTGATCTACTCACATTTTGTCATGGTGGGTTGTGTTTAGTGGACGAGCGTCAGTGCAAAATTCGAGTCGTGGAGCGATTGTCCGAATTTCACCAGGCA
ATACGTACAACAACAACAGAACCTGTAGCGAAGGATTCATTGTCAGTTGCTTCTGGGAACAAAAGCGACGAGAGGAGTTCACTGTCACAAACAGGAAGCA
GATCGTCATTATCAGCTACACTGCCGTCATCAGGTTTATCAACAAGCCAAGTGCAGCACTCTAGCCATCAAGTAGCTCAATCGGGTGTCTCTATAGGATA
TTCAGGCGCTTCGATCTCTTCCAGCGAAACATCGACTGCGTTAGATGACTGTACAATTGAGTCACTGAGTGACAACGATTTGGAGCAGCTCTCAGAAAAA
TTATTAGAACGTGTTGTGCACCAGCTTGTTACAGTGGCACATACAAGCGAAGATCTGCTAGAGGAACTCAATTCCCTGGACGAAACTGGTTTGAGCTTGT
TGCACTACGTGAGCTTTTACAACTATTCCCAGTTGGTCCCGGTGCTGGTTGCTCACGGTGCACATATTAATCAGCAAAGTACACAAGGGCAGACAGCACT
GCACCTAGCAGCAGGGTGTGGTCACGACGAAGTAGTCAATGTCCTACTTCAATCTGGAGCGGATTTACAAGTGCGCGACTTTGATGGACTTACTGCTGCT
GATCGAGCTGAAAAGTCAGGGCACACGGACGTTGCTGCAAAACTACATCATCACATGGGAGATGAGGCTTCAAGTGACTTGTGTGTTGTCGATGAGATTT
ATGGATTTGAAGGATCGCCGATGGAGATTGATGATGCCCCAACACCTTACATGGACGCCGGAGACATGGGACTTTTGGCTAACAATGATCATGTGGTGCC
TAGTTCACGCGCACCGCGTTCTCACTCGAACAGTTGCGAGAGTCCTTGTGAGTCAAGCGTATCGTCGAAGGCGACATCATATGTACGTGATAGATATCTA
TTGTGGTGGTGCCAAATTATATTGCTTACCAGAGTGTTTGAACTATGACTTTGTAGCTAGGAGAGAATCAAGAACACAATCGGAAGCTTCTACTTGGAGC
CTTTTCTACCATGAGCTTGCATGATAAATGTGCACTTTCGCTAAGTATTTCAAGAGACTCGGCGGGCTACGTTACCAGGCGCCGTGAAAGCAGTGTTGGA
GAAGATATGTTAGTTTCACCCAGCAGTAGCACAGGGACATCAGTTGGCTTTGGTTCATCGCCAGCAAGTATGGTTGGTGTGGATGCCAACCTTGTTGGTG
CTCGACTGGTGTTGTCTGGAGCTGAGAACGATTCGGATGTTCAGAGCGTGATTGCTGAAGACGAAGAAGGTTTAAACAAGTTGCAAGCAGCAATGGAGCT
CATGGGTCCAGAGGAAAGACAGTCACTAGAAGACGAAGTGAAAGTACTGCAGCATGGTATCCGTGCGTGGCTGCTCAAAAGAAATTGTAAAAACATGCGC
GAGACGACCAAACAGCTCCGCGAAGCAACCCAAAGTATTGAGGACCAACAGAAGCAGCAAGAAGCAGCGGAGCACCAGTCCCTGGTGACAAGCGAGCTTT
CAGAACGTGAACGAGCAGCTGTAACTGTTCAAGCAGCAACGCGCAGCATGCTAGCTCGACGCAATTTCCTCCAGACTAAGCACGTCGCAATCAAGTTCCA
AGCTGCCACACGCGGTGTACTTTGCCGCAAAAATTTCGCGCGCATGAAGGCACATGCTCTTGCATCACTGGTGATCCAGCGCAATGTTCGCGAGTGGTGG
AATAAGCAGCCCGCCGCAACTCGACCAGGTAACATCAATAAAGAAGCTGACGACAAAGAAAAAGACTCCGAAGATAAAGCCCCAACTCCGCAAGACGCGT
ATGAATAAGCATTACGAGAAAGCACTGCAGTATGTAAATGACACACCAGTATAGCATAGTCCACCACGAACCAAACCGGTTTCTTGCAACTCTGCACTCT
CCATCTCGTTCTATTTGCCGCTCCTTCAGCACTTGTAGCCTACTGATGGAACATGCCTCTGCTAAAAACCTGTTTTACTCCATGGTCTCAGCTCCTTCGT
CCGTGTATCGTCGGAACCCAGGGATGGGAGGCGTCCAGGTGGCCATGCCGCGTTCTTCCGGCACGGGAGCATCGTCGATCTCTAGAGCTTCGGCCTGCAG
CTCGACAGGAAGCGCGTTGATGGCTTCCCACTTGAGGTCGATCTTGGTCTGCACGTCGCGCATGAGATGGTTGTGCTCGATGGTGCTCATGACGTTGTAG
CGGCGACCGATCTCCTGGTGGCGCTGCTGCTCCTCATCTGTCCATTCCTCCCTGTAGTAAATACAAGAACGACCTTTAGTCCGTTATACTGCTATGATAG
TACAGCATGCAGCAGCATCGTACGCTTCAGGGTACTGGCCCTTGATGGCACGCAGCATCTGCTCGAAGTTGGCGTCATCTCCACCCTTCTTGCCCTTCTT
CTTCTTGTCCTTCTTAGACGCAAAGCCACGTACGCTCAAGGAGGTTGCAGCCACGTCGGTCAGTGCGCAAGCAGTCGTGCGCTTGGCGGCCACAGAAGTC
ACGCTACGCAGCAGCAGAGCCATGTCTCCTGCTCGAAGTAGCGAAAGTCTCTCGACCACAAGTGCCGCTTTCAAAATCGTATCCACTAAGTACGAAATGG
TGTACACCACAT