Description :
From Genome Similarity Track
Location :
Scaffold_262:150- 4922
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap-pug3_contig_262-abinit-gene-0.42HECT E3 ubiquitin ligase

Sequence
4772 bases(100 bases per row)
TTTTCCTTCATCAGAACCTCAGCTGATCGTTCGGATTGATGTCGTTCCACCCGGTCATCTCCGTGTCCGCCAGTCGAAAGTCGCCGTCCATCTCGACGCA
GTTCCGGATCGCGTACAGCATTTGCTTTCGGCAGATCTCATCCGTAGAATATCGCGGCAGTTGGAGCGCGAAAAAGCACGTGTGCGACTTCGGGAGCTGT
GAGTCCATCCACCCGCCACTTGCACTCGAACTGCCGCTGGACTCGCCATTCGCGGTGCCTCCGTTCGAGGCCGGAGCGAGCGACTGGATCTTGAACTTTT
GGTGGAACTGCGCTGTTCCCGCTGGTAATCTTGATCGCGCCCACACAAAGCGCAGGAAAGAGCGCTTGTCTTCCTCTTCTACCGACGCCAGCACGCGCCA
GAACCGCTGCACAAACTCGTCCTGAGCAGACACATCTTCGTCGTACTCTGTGTTTTGTTTGAGCAGATTCACATCCACCTCCGCAACTCCACAGGCGCGT
CTCTCCAGCTCCTTCCATGTGTACAAGCTCAATGCTGCGACAGGTAGAATAGAATTCAAGCCTTGTTTGATAATGTTCAGCACGTCCTTAGACTCGTCCA
TGCGGGCTCTAATCACCGCAGTCAAGTACACCTCAAGATTGTCAAGAGTGACGACTTTTTCGGCGCCCCCATCACAAAGTTCCATTATTTGACCGTCCGA
CAAGAAAACAGTGAACGTCAAGTCCATTGCTTCGAGTTGCTCTTCAAGATCCTGAAGCCGTCGATCATTGCCTGGCACACCAAGGGCTTGTAGCTTCTGG
TACTCACTCAGCATCGCGCGCAGCGACTTCCACAGCGTGTATGCGACAAAGTCGACCTCTTTGAGGTTCTGAAGCGCAGCTTCTTCTTGATCTGCACTGT
CGGTCTCGACTTCACCTGCGAGATGCTTCCACACTGAAATTGCCAGATCGAGACGCACGCATACACGCGTTCGAAGGCACGTGCCAAGCATTTGCCCCAA
AAAGAAGAGCATCTCCCCATGCAATTGACGCTTCTCTATGGCAGTCTCGTGACCGAGATCTGATGACTCAGAGCTGCTATTTTGTTCGTGCATCGTATTG
TTCCCATTTGCCCGAGACTGGTTGCCATTTCGGGCAAGTGGCGTATCTCGTAGCAGCGCTGCATTGATGACAAACTTTTCTCGATTAGCGCCAACGCCAT
TGCGCCAATTCGGACTCGGCAACAAGAACGGCAGCAAGCACTCGGTTGGGTTTTCCTCAAGCTTTGAGCCACCTTTAGGAGAAGTGTTCTCTTGCTGCTG
CTGCTGCTGAGCGCCAGGATCGAGATCGTTCTTGCTTCGCAGCATTTGCAGTTCAGCGAAAAACTGCGAAAAGAACTCTCGATACGGCCCTCCATAGTCG
TCGACACCTTCACCTTCGAACTTGACTTTAAAGCTTCGTAGTTGTCCATCGTCCATGGGATGCGAGTACACCATTCGAAGCGTTTTTAGCGGGAGGAAAT
GCAATTCCTCAAACGCTTGTCCAAACATTGAGAGAAAGAGGCTCTTCGTGCTCCCAGGGTGGCACTTGGCAGCCGCTGCTTTTGGACGATTGATAAGAAC
CTGTGGCAGATCCTCGGGGTAATCGTAATCGTCGTCTGCTTTCTTCGGCGAGTTTGCCGTTTTCTCCATCAAAGCAGTGAAAAAGTCGTTCTTCAGCGCG
ATGAAGATACTGCCACGGCATTTTGATACCAGCTTGCAGGGCAGCAGACTCGAGTCCGGCGAAAAGTAGTGCCACGTGAGGTCAAAGTATCCAATGACGC
GGCTGAAGTACGCGTTGAAAAAGCGCAAGAAGCCCATTCGAGCGACAAGTTGTGTTTTCTGGCTCGGTTTCGTGAAGAATGCCATGCCTGACCCGATTGC
AGTTTCCAATTCGTTTGCTTTGAGGCGAAAGAGCTCCAGCATCTCCGTCGGCGAGACGTTCCACGGACTCACGCTCGATGTTTCACAAAAGTCGTTCACG
AGGCTGATCAGCTCGCGATCGATTACTAAACTCCAGCGCGTATCGTTAACAAAAGCTTCAAATTCTTCAAATGTAAGCTTTGCCGATATCGTGCTGTCTA
AGTGGTGTGCCTCATTGACTGACTTTGTTGGAATTTTCTTGATCATTGGGTCAACTATTCCATTCGCGGTGTCTTGAGCACTGGAGAAACTTCCACTTGT
TGTCGACGGCACCTTTGACAGATTGTTTACACTTATTAATGTCAACGATCGCAGTTTGGAAGGGTGGAAGAACCAAGCGCCTTGCTCACCGTCCACATCG
ACCCACAGCCGCTGCTCTGCGACCCCTACGACGACGCCGTTGCCTCGCACAGTGCGCACGCGCTCTCCAGACTGGAAACCAAACGGAGTGCAACTATCAC
AAGTGATATCAACCCACAGAGGTTTCCCAGCTCTGGTAGTGACATACTTCTTCGACCCTGAGATCCACTGCATTGTCATCTCGTACGCAGAACGAAGAGG
CTCCTGACGGACTGACTGCTTATCAATCATGGATGCCATAAGTTCACACACGATGACGCTTTCCTCGATACTCCCAGGTGTAGTTGACTCGTCTAGTTTG
CCGTCAGTCGCATTCGCTGGGATGTCAAGTTTGGTTTGATCAACCACAAGGCTATCCTGCACAAACGATACTCTTTGGTGTCGAGAGTAAAACGCTACTG
CCGGGTACACTTCGCCGACGATGTTTTCAAACGCAACGCCGAGATTCACGCCGTTTTTGCTGAAGGAGAGCGTGCCTCGTTCGCAGTCGAGCTGAACGCC
AATGCAATCGCCTTCACCGAAATTGTCTCCGTAAGCCCTCACGCGGTTTCTCTGGTAATAGAGTGCCTTGTCGCCAATATACCCCCACGAATGATCGTCA
GCTCCAAGAAACGAGTCGCAGCTAGCGCGTGAGTTTGCAACACCGACAAAAATGTACGAGGAGCTCGACTTTTCGATTTGAATCTCCCAGGAAATGACAC
CCGTCGCAAAGCTCTCGGTCGCAAACACAGTTTTCCAGACTTCGTTGCCAGAGTATCCTACGCTGATTGCGTCGTCGGAAATCGTGAGCAAGTTGCTGCG
GCATCTCTTGCGATCAAACGCGAGCGAGCGAGCTGCGTTGTCTTTGTTGTGCGGTTTTGCAAGTGGAGGCGACAGCGACACGAACGGATTTGCTGGCAGA
GCTCGCAGTGTTGACTTGGTATTCAGGCATGGAATGTGGCGCAGGACATGCAGGATCTCGATAAATGCCTGTAAGTACAGCGAGAATAGCAACCGGTTCT
GGACCAGTTCTCGCGAATGACGCTGTTTGGCAGCGTTTAAAAAGTCACTGAACACCAGCTTGCTGTCTCTGATGACTCTTTGTGCAAGCTCGCTGTTTTC
TGCTGAAGAGATCTTTTGTAAAATCGTACTAATCGCATGGAGCGTCAGGAACTTGAGTGGCAGGTTTGTAGCCTTGAGAGTGTACCGGAGACGCTTTAAG
ACAAGTATGATTGCTTCGGGCATTTTCCATGACAGAGTCGATTTACTCGTCAGCAGGGTGTCCAGCACCCATGACACAAGTTCAATGCCCGGCTCGGTCA
AAACGACATTGTCTGAGCGCGTGAGATCGCGCTGGGTCCACAAGTAGGCTTCGTATGTTTTGTTTGAGGCTGCTTCCTCAATTTCACGCAAACAGAAATC
AAAAGCTGCAGCCAGAAAAGCGTCAAAGTCGTGCTTGAGAAAGAACGCAATCACCGAGGATAGTACGTCTTCTGGGCTTTTCTCTTGAAGATGACCAACA
CGGTCGTCTTGGATGATCACTTTGAACTGGTTGCCACGATGTACGACGACTTTTAGTAGCTGGAAAAATTGGGTGTACTTGACTGAAAACTGGATTGCGG
CGGAGGAATAGTGTGGCTGGTCACTGAGATGGAAGCACAGAGTCGTCATGCACTGGCGAGCATACAAAACCGATAGCGTCTGCTCCAGATCCCGCAACGT
TGTCACCAGCTCATGAAAGTCCATGCGATCGATTCGAGACAGGTACAGAGATTCGTCAAGCAGCACGTTCGCATTGAACGAGGACGCTTCTTCAAGGCTA
GAGACTTCTTCGGTTTGTGGCTTTGAACACGACTGTAGCTTCATTTCCACGGCCTCCGACCTCCATGACCTCATGTAGCAATGCCTGATATTCGATTGAT
ATCCTCCATCTTCAAAGGGAAAATACATCTCGCCAAACACTTTCCGCGCCATTTCTCGATCATTCAGAGGAGGAGCAACACTATCGAGATCAGCTCTTTC
CGATTCGTTCGGTTGGTAGGCTTTCCCTTGAAGTGAGTTGGTGGCGTCCTGTTTCATCTCAAATGAGGTATCTCTTGCACCTGAACAAGAAGATCTCCTT
GTCTCAGTCCTGTTAGTCTCTGCGTCAAGACCTGGTGGATCTTCAATGCTGTTGTCATCTTCCTCCTCGTTAAATCGCGGAGTATCCCGTCCGCGGTCCC
GCTGTTTGTCTAAAGACGACTGAAGTCTGCTCAGGTATTCCAGGTTGTCGACTATCCATGCTGAAGCACAAACGATATCGTTTTCAGTCTGCTTGAGTGC
CAGAACGCACCACTCTTCGGGAAATCCCATCAGCATCAGCTCTTCCACGAATTCAGCGCGATTCCCTTCTGCTTCTTCGTCTTCATCCTCTTCGTCTTCA
TCTTCCTCCGCCTCCTCATCCTCACCATCCTCATCGTCCTCGTTTACATCATCATCATCGTCTTTCGCATCG