Description :
From Genome Similarity Track
Location :
Scaffold_133:150- 1496
Sequence
1346 bases(100 bases per row)
CCCCTGAATGTCCATGCTCGCCATGCTGCGGAATACGTATCCTCTTGCTGCATTTGCCAGAGCATCGCATGTTTCATTTTTTGAGATTTTACGGCCACCT
CAATCGATACGAGCCCACGCCTCCGGCGCCTCGTGGAGTGTACAGAAGTCCAGGATTGACCTTATGCCTGCTTGCTTCCGTTGCTATCGAATGGCGCCAC
AGGAATTGCTTCTGCAGGTGTCGAAGTTCCTTGCCTGCCCACGGTGGTATATCGAACGCTGCGGCCGTGAACAATATTGCTGTTAGCATGATCACATTGA
GGATGGTTACTCGTAGCCATCTGCGCCGCCGTTGCTAATCTTCGTTTGATATTGCGGATCCGGTGGGCCCAGTTGTGACCCGATAGCTCCTGAGTTCCTA
CTTCGTAACCTAAGTAACGAGTAGTTTCTCCATGCCCGAGTACCGGTATTCCATATAGCTCATTCATCTCCACCGCCGTATTCAGAAAAAATAACTTGCT
TTTGGTGGGCTGGACACTTAGGCCTGACAGTGCTCCAAAGCGCCGAATTATATCCATCACCCCGGGAGCTGCTTGGCTTCTTGAAGGAACACCGTCGAGT
CGTCCACAAAGGCCGAGAAGCGGTGCTCAGCATCCGGTTTGCCCGGTACGTTAATCCCCTGCAACTGTGAGTCCTGTGAGATAGATAGCGCCAACACCTC
TGCCGCGATCAAGAAGAGCAAAGGCGCCAGTGGACAGTCTTGGCGAATGCCTGATAGCACCTCTGTCGGCTGCTAGAGTTCCCCATTTACCAAAATGCGA
GCTGTAGTCCCATCATGCAGTCGTCGTAACATATCTACGAATTCTTTCGAAAAACCAAAGCGTAATAGCGATAGGAAGAGAAATTCCCTGGCCATTGTGT
CGTACGCTTTCTTAAAATCCAGCAACACAATCACCCTGCTTAGCTCTGCCGCTAATTCAGGTTCCCCTCTCGCCGATGCCAGGACCGCCAACATCATCAT
CACTGTTTTCATCATTTGTCTGCGGTGCACGAAGCCTTGCGGTGTCGTTCCAATAACTTTGCCTAGAATCCGCTGTACCCTTGTCGCCAAAACCTTGGTG
AATACTTGTATCCTGTTTGTAGAAGCGAGATAGGGCGGTAATCCATGGCATTATCCGAGTCCCCTTTCTTTCTGAGTGGTATGATGAGTCCTTCTAGAAA
CGACATAGGGGGCTTACCACCTTTCAGCAGTTCATTACCGAGCGTCACCAACGCAGGCGCCAACTGAGCCTGCGCGTCCTTAATGAGGTCGTTGTTCAAT
CCATCTGCCCCTGCCGCTTTGTGTCGATTTAGTGCCGATATCGCCT