Description :
From Genome Similarity Track
Location :
Scaffold_689:15- 2370
Sequence
2355 bases(100 bases per row)
TCTGGgAGGCGCagTATGTTGCACGAAGGTGGTCCGAACGCACCTCGCCCATTGGCCCATATTCCGTCCCCATACTGAGCGCCTGTTACGTCCGCTTGGT
CAAGGGCGACGGCGGCGACGGCGACGGCGACGGTGGCAGCATGGGCGACATGGACGCGTACAAGCAGGAGGAGGGCGACCGGCCCGTGGAGCACTCCCCG
CGCGGGCGCTACATCCGCTTCGACATCCGCCTGGGCTCGGGTGCGTACAaGACGGTGTACAAGGCGTACGACACGGACCAGGGCATCGATGTGGCGTGGA
ACGCCATTGAcATTGGCGTGCTCCCGAGCTCGGAGAAGACCCGCATCATCCAGGAAGTGCAGCTGCTGCAGAAACTTGAGCACAAAAACATCATCAACTT
TTACGGCTCGTGGTTCTCCAAGgAGAAGAACCAGGTCGTGTTCATCACCGAGATCATGACcTCAGGCACGCTCAAGTCGTACATCAAGCGCGTGCAGTTT
GTCAAGTGGAAGATCATCAAGCGCTGGTGCGTGCAGATCCTCGAAGGACTGCACTATCTGCACAGCCAGAACCCTCCTGTGGTGCATCGCGATCTCAAGT
GCGACAACATCTTtATCAATGGCAACACAGGCGACCTGCGGATAGGCGACTTGGGACTCTCCACGCAGCTCGCCGTGCACAAGCGTTCCAAGGCGCAGAG
TGTACTCGGCACGCCCGAGTTCATGGCCCCGGAGCTCTATGACGAGAGCTACGACGAGAAAGTTGATATCTACGCCTTTGGGATGTGTGTGCTCGAAATG
GTGACCAAAGAGGTGCCATACTCGGAGTGCATTAACCCAGCACAGATCTACAAGAAGGTCACGGCTGGCATTCGCCCGCGTGGCATGCAGCGAATCATCA
GtcAGGGCGCGAGAGATTTTATTGAGCTGTGCCTATCGCGAGGTAACGGCCAGATCGACGTGTCGGCACAGTATTTGCTCAACCACGAGTTCCTCAAGCC
ACAGGATGACGACAATGAACTTGTGCAGGTGCTGGACGAAGACGAGCTGGAGCGGGACGTTCCCCCGCCACCTCCTGTACCGGTGATGAATGCCAGGGCG
TTTGCGGACCAGCTTGACATGGAGAGCGGCTCGAAGGGGAAGGACCAGACCGTGCCTGCGACGGAGCGAAGAAAGCAGAACGCATCTCTGTCGATGGAGC
CGGAAGAGCTGAGCACTGGCTCGGCCGAGAACTcGGCCCCATCGTCTGGTGTGCAGACTGTGGATCCTGTGGCAGAGGACAAGTCCCCAGGAAAGCACCA
CGTGCTCGTGCctCCAAAGACGTTGGCCACAAACGACGTCGCACCTGCTCCATCGACGCTTCCCCCACTCCCACCGCTGCCGCCTCGTGCCCCAGTCGCT
GTGCCAGTCGTTGAGCCTGTGGTCGATGAACCTCTTTCGGATAAGAAAGGAGACCAAGACCACGTCGATACGTTCCTCTCGGGACTTCCACCAAGTGAGG
CAAACATCCGGAATCACCGAATCGCACTCATGGGTGGTCGGGGACAGCGCATTGAAACGCCAGACACGCTGTACGTCGACGATAATGGGGATGACAAGCA
AGAGCCGCCTGCCGCGGCTCCAGGTCCAGCTGCGGTTCCAgCcGCTGCTCCAGCTGCAGCTTCTCCTGCTCCTCCCACTAGCGATTCCGGCGCGTCACCA
GAACCTACaCCAGCACCAGCACCTCTGCCCGTAGCGCCAAACACCGAGCGCGTGGCAAGTCCCGTGCTGAGTGAGCCACCGCCTGTGGCAGAAaCTCCGG
TCGAGCGTCGCGTTCGTACCAACACGATAGACAGCACGGGCAGAGGCACGCGTCCTGCATCCGCGCAACGAAGACGTGGCAAGCGATACGACATCAAGGC
GTCCAAAGATCCCGACAATAGCCACGGCATCTTGTTGAATCTCCGTATCGCCCTCGATGGCCGATCGAAaGAAATCAAGTTCCCGTTCAGTTTGTTTACG
GATAGCCCCCATGAGGTGGCATGCGAGCTGGCCGTGGACGTTGGAATCCTCGAGCCAGACCTCGAGGACATCGCTGAAGCGATCTCCTTCCTTGTAACAG
AAGGCAAAATCAACAACTACTCGAATGCCGACCAAGACATTTGGGATGAGGCGCCGGAGCCGCACGGCTTCCCCAGTAAACCACTTCCCCCTGTGTCAAA
GATGACGTTCAGCTCGGtCCCcGGAGCGCAGGCATTGGCAGGCTTCCCGGAAGGCTTGCAaCCCGTGGCATCCGGCATACTGCCAGCGTCCCAGTTAGAT
CCGTCTGCGCTGCGCATGTCTGACAGCGGATTGCCGTCAAGCATCTCGACGACCT