Description :
From Genome Similarity Track
Location :
Scaffold_2849:15- 2228
Sequence
2213 bases(100 bases per row)
CGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGACCCCTTGG
TGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGCTGAGATCCAAGCAAGGGAGGTTGGATCCACGACGGGGGACGATCC
CCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATTCACAAGTGGATCCAAGC
TTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGACTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAA
CTGTTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAAGGCCGCGGTGTTCGGATCCAATGATGGATCCACC
GAAGACGGAGGATGAGCAAGTTTGTTACCATGAGGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGGTGATCCCGGAGGTACCACTGAC
CACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAATAAATCTGGGAGAGCCGACAT
CTGCTGATTGGTAAAGGTAATGCGGGACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGACGCGAAACCGATCGCTCAGAGGTGGCGCCTCA
GTTCCGAGAAAAACTATCGGATCTGAGTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATC
AAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGACTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGT
TGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATT
CATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCAATAACGCCCTCTATGGA
TTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGAACCCCGT
CCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGCGTGACATCCCTACTGGAGGCGTGTAC
TAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGAATGCGCAAGGTGAATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTAAAGGCGAAT
CCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATTCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCG
AGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATGAAAATCCAACAAGCTCT
GGCCCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTACGATGTCAGAAGAGGACCTAAAGCAGGAGCCGGATCCACCCCGGGACCAACGAAGAGAG
GATCCAGTCTAGATAGAGACGACAGATCAGAACGTGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCATGGAACTAAGGAACAGGATCG
CGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCACTGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACA
TGATGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGTGC
GTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCAGGCTGTTCAAGTCAGCCGGGTTACAAG
GACGTTTGGGACA