Description :
From Genome Similarity Track
Location :
Scaffold_3088:15- 2146
Sequence
2131 bases(100 bases per row)
GATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATA
GGGTGACCATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTA
AGGGATTTAGCGAGTGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAGTATCAATACAGAACCCAATTTGCACAGTAACACGCAAGTGCC
TTCCTGCCCTCAGAAACCGGAACTACTTTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTG
GCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAAC
TCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGAAAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGAT
CTAGGCCCCGGATCCGTAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTTCCACTGCTGCTCCACCCCATCCCCA
CGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTACGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGT
TCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCG
CTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAG
GCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGG
ATCCGGATCCGGATCTAGAAGAGAAACCTCGCTATCCTCCCCAGGTACCCCTGCGGATCTTGGCGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTG
AAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACATCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAGATGA
GTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGGGTTTGTGTATCG
CCACCAAGCTTTACGCGACTTCCTGCATCAAGACCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACG
AAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACAGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGGGC
TAGATCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGGCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCATCGCC
GAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGCATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGG
GCATCCATGCTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGATCTGATACAAT
CCAGCCAGGATCGAGCCAAATCCGGCAAGAAGCCAGTGGAGTTATCGTCAGATCGGGTTCAAGGTAATCGCCGCACAGATCCTGACTCGCCAGTGGACCA
GACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCAAAGCTGCGATGAGTCGGTTTCTGGCCGAACAGGGTATGAGAGCGCCC
GTGACACAAGCGCAAGTGCTCCACGAACATG