Description :
From Genome Similarity Track
Location :
Scaffold_4983:15- 1836
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4983-snap-gene-0.1Inositol-3,4-bisphosphate 4-phosphatase

Sequence
1821 bases(100 bases per row)
TTCGTCGCCATCGACCGCATCCGACCAAGCGAAAGTCTCCATCTCGGACACACCTACACGTACGCGAAGCGCCACTTTGTCGCAGACATCGAGCCATTTG
ACTTGCGGATAGAGGCATCGGCCGACGTGTTCACTCAGTCGTCATCGCCGAAGGACAAGCCCGCGTTATTGATCCACCACTGGAATCCGCTGGGAAAGGA
TATCCGTCGTCGCGAGCCTTCGGCGGCATGGTCCGCAGCAACGGAGACTCATCGGACGCGACGAAGTTGTTCATCTCGGAGGAACTGTCGGCCTCGTATT
GCTCCGTTTCCGTCGCTGCAAAGTACATGGGCCTTGCGCAAGAAATATATCGACAGCGCATTTACGATGCTCTACTGCTCATCAGGGATATCGAGAAGAA
GTATGAGAAGAACCCGTCGTCATCCAACAGCCTTGCCTGGTCAGAAGACGTGGTCAACCTTCACCGTGAGATGATTCGCGATGGCGAGAACCGCGTGGAA
CACTACAAAAGGCGTTACGCTTCCAACGACGAGTGTGAAGAGTACTACGAGAAGCTGCTGGCCATGCTAGAAAGTGGTATGGAACCGGGCATCACAGGCT
GTCTCAAGCGCAGCACCCAGGAGAAAGACAAGCGGTCGGAGTTCATGCCCACCAACCTCAGCTGCCACGTTGTGCGCGCACGACGCGTTGCACGTTCCAA
CCCATCAACTACGAGCAAGGAGCAAGAATCGCGGGAGAAGTCAACTGGCGCCAGTGGTGATGAGCTCGTGTATGCTGTCACTACTCACGGATGCCCCGCT
GCCCATTGCTTGGGCTTCAAAGAAGGTGGCTTGCGTCGCCTTCAGCAACTGTCACAAGCCAGACGAGAGGACGACGTGCGCCTGCTGGACCACATCGAAC
AGCGCCAACATATCGTTCGATGCCAGGTTCTAGCGATTGCATCCGCTGCCTTTCTCAGTGTGGTCGGACTGGCGGCGAATCAATCTGCGCGCCACCAAGA
GCACCTTCAACTCATGTGCCACACAGGATTCCTCCTCAGCATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTAAAAATCAAGTGTGCCAAGTGTGTCACC
ATCATCGACTCGGATAATGGTGACAATGTCGTGGCCATCTTTGCGTTACAGAGCGATGTGTTTGCCACGCTCCCCGACGTGCTTCGTCAGGGCCAAGCTG
TAAAAGTGCACAGCGTGATGTTCACCCTAGGCATCAGCGAAAAGCAGCCGGCGACGAACTACGCTGATGACATCAATATCGAGAGTGCGAACCGTCTGGT
TCGCTACTTTGAAGATTACAAGACACACGTTATGGCGATGCAGCCGTCAAATCCCCAGCGCATCAAGGATCTTCCCAACCTTGAGATCCAAATTAAAATA
TTTGCCGAGAAGCTGTACCAATTGCGCAAGACGAGAGCGCCAAGAAAGAATGTGAGTACCCTGATCGAATCGAGCGAGCTATGCCGCCGTCGCGGCGGCG
GTGCGAGCCGCACGACCTGCTGCAGTAACGGCAAAGACCGCACGGCCATGTCCGTCACGCTCGAGTTGTCACGTCTGCTGACCGACAAGTTTCGCGTGAA
GCAGGGTGTACACCTGTGTAACGCCATGCGCGAACGTGGCGTGCGTCGCGTGAATGTGCTCGCTAACACGGGCAGCAACAAGTTTGCATTCAACTCGTCT
CAGCTCAAGTACCTTCCGGAC