Description :
From Genome Similarity Track
Location :
Scaffold_4466:15- 1129
Sequence
1114 bases(100 bases per row)
GTGTAGGACATCCTGTTGCAAGGTTTCTGGTATCACCAGTCTCATCAATCTATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAG
TCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTC
CCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCT
TCCTCTGGACCTAGTGACGGCCATCACCTGGACCGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGACCCTGATGC
CCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACT
CGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCCCACCTCGCACCTGTCTGATCAC
CAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTATAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCTCCTCATTGACGGTG
AGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGG
ATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGTTCTTTCTTAGGAGCGATCCTAGT
CAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACACTTCACAATCTCCAGCGTCCAA
GGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGAGTGTCGAGTCAGGATCCGGATGGGTCT
TCCCACCAGCAGGT