Description :
From Genome Similarity Track
Location :
scaffold_1537:15- 1085
Sequence
1070 bases(100 bases per row)
CCCTAATGCGGGAAAGGAAAAAAACTAAAAAATAAAGGTAAAACGGAACAAAATTTTAAAAAATTTACCCTTTTTAAAAAGACCCCAGAAGGGACCCAAA
AAATTTAAATTTTCAAAAAAAAAACTGCGCGGGGAAAAACTGATTGGGAAAAATTACCCACCCGGAAAAAAAAAGGGAAAAAGGGTTAACCCTTTTTTTT
CCCCCCCCCCCCCCCCGAAAATTAGACTATTGTCACGGTTTGCAGGTACTGGTATCTGTTTGCAGGCAAAACTGACCAAGTAAAAATGTTCTAAATACCT
GTTAAAACCTGAGCAGCACCAGAACCCAGAGACAGTCCCTCCACCAAGCACGAGGTAGATTTGCAAAACTAGCGAGTACAGTATCTGATCAGATGCAGGC
GAGTAGATCTGGAGAATAGGCGAGCAGTTGTGTAGAATTGGCGAGTAGTTGTAAGAAATGGGCGAGTAGTTGTGAGGAACGGGTGATTAGTTGTGAGGAA
CGGGCGAGTAGTTGTGAAGAACGGACCAGTAGATGTGAGTTTATAACAGGGATTGGCGGACACTTGAAACGAATTGTTGGTTGACGTGTAGGAGAAAGAA
CACAGTCATAGGAGGCACACTATGCCTCCGCGTATACCTTGGAGCGAGGCCGGTGTCGAGATCTCTGTTGAAGAGGGCGACACCGTTTTGGGGCGGTTTA
AGACTCAAATTACTACCAAGAGTGAAGCCGTTCCACGTACTTTTTGCCGGGGAGGGCACCACAAAATGCGCTACAAGCTGTTCAAGTGTCCGCGCGATGT
TTGCGAAGCTACTGCATCTGGGCAGTGCGATTGGAGAGGAAAGCAATTGGTCTGTCTGAAAACGCACAAAACGTCGGTGTATGAGTTCGGCAACTACCTG
TTCGACGCTCCATCTACACCGCGAATGAAGCTTTCATCAACTTAGAAAACATTTTGCAAAGATTGGACGGAAGAGAGGCTTAAGCCTCTGCGAGTTCGGT
ATGCGATGTCAAGAAACTTTGGTGTTTCGCTAGACGAACTCCCAAACCTCGTTAAAATCTAAAACTTTGT