Description :
From Genome Similarity Track
Location :
Scaffold_81:149993- 151569
Transcript NameFunction/comments
g14524.t1XP_009516724.1 hypothetical protein PHYSODRAFT_471974 [Phytophthora sojae
g14525.t1hypothetical protein

Sequence
1576 bases(100 bases per row)
GCATGGAACCCGTCGACGGCTTTGAGGAGATCGAGAACGGGAGGTTTAGGTACTTGTGCGCGATCTGCCGCAAGCGTGGCGGTGCCTCGGTCATCTGCGA
ACAGGACGGCTGCAATGTGGGCGTGCACCCGCAGTGCGCAGCAGACGCAGGGCTTATGATCGGCAACGAAGGCAACTTGCTCGGCGTGTACTGCGACAAG
CACTTGCCGACGTCGCGCATCCCGGGAGCCAAGCGCTGGATCAGTGATGAAGATTTAGTGGAGGAGATCATGAGCGAGTACTCCGTCGACGACGACTTTG
AAGATGAAGACTTTGGCACGCCACACTACAGCGACGCTGATCGCTACGCGTTCATGCTCGAGTCGACGCCGTATCTGCACTGCAAGCAGAAGCTGTTGGG
TTCTACGGCCACGCTACACTTTGGACCAGCTCCCTTTTCTGCGGCGACTGCTCCTCCAAGCGATACTAACCGAAAGCTGTTTGCTGGCGCCAAAATCACT
GCAAACGCCTACGCACCGCCTGCAATGGTAGTCCAGAGTATGAGTACGCAGCGCCCGGTCACTTTTCCACCGCCTGCACTATCTTCGGGTGAGGAGCGAC
TGGGACTGCCCGAGTTTCCGAAGGGAAGGCATGCGGTTGGAGCTATCGTGGACTATTTAGCCAAGGCGCAGGACGAGTGGCAACGCGCGCGCGTGGTGCA
GTGGGATAAGGAGAAGAAGATGCATCTCGTGCAGATTGTGGCGTCTGGGCAGAAGGTATGGGCTAAGCTGGACGTGGATAACACGTTGGTGTTGTACCTT
CCGGACGAGGAGAATATTGTGGATGGCCCAATCGTCAAGCTCATCCGTCCAGTGACCCAGGGCGCTGCGCAGTGGCGTCCGAAGCCGCGTCAGTTCGCGC
CAGCATCATGAGGACTCGGCAGTGGGTCGACATTGATTTAGGAAAGCAAGACGATAGCTGGGCGATCGGGTAAGCAAATTTGATCTGTATCATGGTCGAG
TGTATGTGGTTTGGTCTGTTGTCTGCGATGGGCAGGCGTCCAAGAAGCTTCACAGCAACGGTGGACGAGCAGCAAGCTTGTTTGAGAATGAACTCCAACT
GCCATTGACATTGTCAACCATCGTGGCAGGAAGCAACCAGCGCCTGGTCTCAGTTACCAAGAACACCCTTGCCAATTCTTCCAGTTGCCAAAGTGCAGTG
AAGCAAGCAAGTCGCAGCGAAGATGTTCCGTCCAAACTGGGATGTGGTGTCGCCGTTCACGTGGCTGGATTCGCTGGCCGACGAGGAGGAGTTCATACGC
GGCTTCGACAAGCGCTCCCCGTCAACGCGTTTCGTGATCATCCCTCATTCTCACCAGCGTGGTCGCAACGATGAACCGATGACCGAGCAAGCACAAGAAG
AGCAAGAGGAAGAGGAGACGGAGACGGAGGATTCGCCCGCTGCTGAGGAGCAGAAGCTCATGGCCGGCAACTTCTTCGACGACCTGCCCGTGGGCGCGAA
GCTTATGGGCACGCAGGTGCCTGCGAACGTGGCGCCGCCCCTGTCCAAGACGAAGGAGGGCTACTCATTCTTCACT