Description :
From Genome Similarity Track
Location :
Scaffold_18:149962- 152152
Sequence
2190 bases(100 bases per row)
AGGTCGGTCCACCAGTGGACCGGTCGGCTCCGCCGGGGCTTCCACCTCTAGTTTTAGTAGCCGCTTGATGCGCGAGATTCTGCCATTCTCTATAGCGACG
AGATCCAACTGAAAAATATCCAGGTCGCTTAGAAAATACCATCCCTTGCCAGCAATCGTCCAATCTCATCAGTGATCTAGTAATATTCTCTTGTCACTGA
CATTCGCTACCTCGAGGTGCTGCGATCGACCAGATCCTTGGGTCACTGTAGGCACCCACTTCTCGCCTCGAGTGACCAACAGCTTCTCATGCTCCACCAA
TTTCATTCACTCTGGCAATTTTCAGGTTTCCCCAGACTCAATCCAGGTCGTCTTATCCGCCCTTATGACCCTCATCTTCGCCCTGTACAACGGTAGTCGC
CCACTGAGCTGGATCCGCATTTTGTCTGAGAAACCCAATGTCCCATCCGCCAGATCCAGTCTTACCCCGGCTGGTACCAGAAAATCCATTTCAATAATAG
CGTCTTGACCAACGAGATCTCCGACCCAAATATCGAACCAATACACTAAGCAACCAGCCAGCGTGATCTTCATCCACATCCTTCCATTCGTACGGTATAC
ACCTCCTCCAATCCCAACACAGTCTTGGATCTGACCTCCATCGATTTGGCACCCAACCTTACGAGCAAAGGTAGAATCTAATGTAGACACCTCTGCACCA
CTATCTAAGAGCAAGATCGCTCTTCCATTGTTGATCTTGCCTCCTATTTTGGCTTTCGAAACCAATTTTCCGGGGTCGGTAACACCAGTGTCCACGTGAT
TCCCCTGTCTATATCCAACACCCTTAGATCCACGGGATCCAGTGACCTGGCAAACCTTGGGTGGATCTGCGATGACTTCACCCTTGGTAGGCTCAAGCCA
TTGGCCATGTTGCCGTTGCTCCAAAAACCCGCGTACTTCTCTCCTCTGTAGACCCAAAGTAGAGGCGACTTCGGATCTGACAATTCCGTCCATTTGGCGT
AAGCTAGAGACCTTGGCAACTGACACTCCATGTAGATCGTGTGTATTTAAGACTGAAGCTAGGAGCTTGCTACCTGGATCTTGCGACGGCTTGGTCACAA
ATGCGTGAATGTAATACCTAGAGCGCTTGGTTCGTACCAGATTCTAACTCGGCGAGCGTCCTCGTTTAACATCTTTTCTGCCACCTCAGGCAACATCCAT
CTATGTTTGGTTGGATCCAACCGCTGGCGGATCTGGTTGTAGAGCTCTTCCATCGGGCACTTTCCAGCATGATGGGTCTCACCGCAGCCCCGACACACGT
AGAAACAGTGATCTTCGGGATGACATCTCTTGCCAAATTTCTCACAAACCAGATGTTTATAGCATCCAGCTTCTGTGTATTTCCGGGGTCCCCACTGCGA
GCACCTGATTTGTCCTGTCTCATCAAAGAGTCCTCGTGATCTGCACATCTCACGATCCCCGGGTAAGGTATAAACCGTGCGGGCGTTGTCTCCCGTCTTT
GCCGTACGATCGTTGGGAGCGGTAAAACAAACTCTGCGGTAATCCTCCGGATCGGAGCCCGGTCCAGATTCAGCTCCTGAGTCGTACGCCATGAATTGGT
GGACGCGTCGAGCCGGAGCCATGGGTGTCCGAGCCTTTTGGCGATACTTGCCAGATCCGACAGCCATCTTCTTCTGGCGATGTTTTGCACGATCCACCAC
CCGCAGCACTTCTTCGAGCTCGTCAGCAACTGGAAGTCGTAGCAAGGTCAACCTGCCAGCCGGATCAACATCTCCCAAGGTTTCGATGAATTGATCCACA
TACTCCCGTGGTACCTTGGATATGTCATCCTTGATCTTCAACTTGGCCCGTAGACCGGTCATATTGAGCCGATTGGGGTATTCTAGCGGGGACTCGTCCG
ATCGGCGGCGAGCGTGGTAGTACTGCCGGGCTACCGACACCCCCAATCCACACCACTTCGTTTGGAAACCACGTAGCAAATCTAGCCACTTGCTCCTAGT
GGATGTGCCCAGCTGCCGATACGAGTTTCTGGCTGGCCCGACCATCAAGTCCGCAAATGTCAGACACGTTTCTGCATCTGACGCTTGATATCCCATGAGG
TCTGACCTAACTTTGCTGATTCATGTTCGCGCTCGGGCTTCGTTATGATGCCTGCCCGTGAACCCCTTCAGATCCAATATGGCTGAGATT