Description :
From Genome Similarity Track
Location :
contig_67:149925- 151803
Transcript NameFunction/comments
g11601.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
CGAGCTTCTGTAGCTCGTCGCGGCAGATTTTGGTCTCGCTGAGACACAAAATGTCGGGGTCCTCCTGGGCCACATATGCTCGGAGATGGACACTTTCGTC
CCGCTTGAGGACAGCGCGGAGACCATTCACGTTCCACGCGACGATTTTCATGTCAGCGTCCTCCGACCGTTTCGATACGTCCTCAAAAGATGGAAACGCA
TCAATTCGTGCTTGAAGTTCGGCGGAAATGGGTGCTGCCGCCATCGGGCGCACATTTTGGGTCTTTGTGCCCTTTTGGCCAGCGAAAAGGGCCCCCCATG
CGCTTTTGGCGTCCGACACTTTGGCTCGTTTCGCCTTGGGATTGGGCGCGCTGGAGGATGTCTCGGAGATCTCGGAGGACGCTTTGACAGTGGTAGCGAC
GGTCTTGCGCTTCTTGGCGGGGGATGACGCCGCCACGGCCGTCACGGCCTGGAGGCGGCCACCTGCAAGCGCTTACTCTGACGAACCATTTTGGTAATGG
GTAAGTCGTTTAGAAATCGTTTCTAAAACGCAAATCAGTACTCTACACAATTCTACTATTATAAGAGACATTTTCCTAAAGGACTGTTTTTGCTGATTGA
TCGGCGAGTACACCCTCACGTTTTGCCAAGTGTGCTAGTCGACGTGCGAATTCGTGCAGTTCAAAACCGGCCCGTGCTTATTAAACACTGTCTTTGCGAG
CAATACTCCACACTGTCCGGAGATTGTTTGGCTAGGACAATGCATACAAGTTTGCCCCCGCGCTGAAGCACAAAACCCAAAACTCCGTCTCGCGGACACA
TTTTCCGACACACTGTACAGGACCGCTGGCAGCTCTAGAAATCGCTTCAGTCCGTCCCTTGTGCCTACCGGTACATGTATTAATAACAACGGCCGTGACC
ACAGCAGAGAAATTCACCCCTCAGATGTCAAAAGGAATACACCATCGGCAAAGTTTCCTGCTGAGTGGTGTTTTTAAAGTTAAAATGCTGGATATGGCGA
TGGAGAAACCACCTTGTCAAAAAAAACGTACTTGACGAACGTGAACAAATTCATGTTTGTTGACGTCTAAGAATTCGCGTGCGTCGGAATGAATGGCTCT
CCCTGCATCGACGGAGTTTCGAGCGTGATGACATGCCGGCTAGACGGAATTGACATCAGAAACTCCCTCGTCGTCCCAGGTTGGGTTGGTTTTGCTCGGA
TCACCATCATACCCCTGGTCGCTGATCGACTTCCGATAGCGGCTTAACATTGGTCGCCGCCGACGTTGTCCGCGGTGTCTTGTATTACTCCTTGCGTTCC
CGTTAGCGATGAAGGTCCATCGCACATAGGACGGTAGCCAGGATGGACATAGGAAGTCGTTGGCATAGCTAAGTGACATCAATGTACCTCACTGAAAAAC
AAACAACAGTAGCGGATTCGTAGCAGTGAACCCGAGGTTCGGCCACTCTCACACCGCTCAATCGCACCTCACCGCCGAGATGACGAACACGACGAGTATG
AAGGCCGAAGGCTCCAACACCCATATCCGTGAAAACCTGTAGAACCCGCAGCGTCCAGGAAGACATGCAACCTGTATAGGTTTTATAGGGTTATAGGGCG
TATGCGTGTTTGCCAGTCCAATCTGTGCCAGGTGTATATATTCTTTGGAAACGGTCGAGAAATCACTGCAAGGCTCCTTGGTTTTGCTTTGCATTGACTT
TTCCACTCGCACATATGCCAGTCAGGCAAATTGTTCTTGTTTGCGCACTTGCAGTGCTGCTCGGCAAGCATTCCCTTCTCTCATTTTTAACTCCATCACC
AAACCCAGGCCACAAGTCAAACTTAAGTTCCAGCAAGAAATGGCCCCTGTCCGCCAAGTACACGGTGCATCTTCCGCA