Description :
From Genome Similarity Track
Location :
Scaffold_20:1499145- 1500686
Transcript NameFunction/comments
Phyin_T30-4PITG_10835Secreted RxLR effector peptide protein%2C putative

Sequence
1541 bases(100 bases per row)
AGGCCCAACAACTGATAGGGATGTTTTGTACTACCTCCGTCCGGAAAAAGATAACCATTTGTTTTTTTTTGCGCAGCGCTCCGCCTCGTTCATTGCGTTT
ATTAATTTGTGAGAGGCTGGCTAGCTAGCTTTATGACCGAGAGCAGACAGTGAGAAACTAAGCAAGGCACAGGCGTTCTTGCTCCGCCGTACAACTACAG
ATACAAAAACGGATCTAAGGCGGCAACTACATCGCCACATTCTGAAGGGGCGCTCAGTGGGGCTTCTGGAACTTCAGCGGTAGGCGGTGGGGGGCTGCTC
GCTGCAAGAAGCAGCATGTACGCGTTAGCATTGGCGAGTGAGGTAGCGTCACAAGGCAGTGACGTAGGGAGAGTGCCAGCTTGTACTTGCTTGTCCTTGT
GCCGGAGGCGCGCCAACTTGTGCGTGGGTGTAAGTAGTGGGCGGGTCTGTCTGAGCGCACGCCGTATGTAGCCTTCCTTGATCAGCTGCTGAACCAGGTA
GCAGCTCACGTTGGACGCGCGCTTAAGCAGACGCTGGTTTTCGCGCTCATTGACAGGAGCTGCAGCGATTCTCTCGCACAGCTCAGCTCGAACCACCTTC
TTCCTACCACATGCGCTCTTTCTTGACTTGACCACGGCTGCTACTCGATCTCCCATCGAATTGATTCCACGCCTCCAAATTCGCTCGACAACTTGGCGGC
CCACACGGAAGTACGCTGCAACCCGAACGATCTCTCCATGTTTGAGCACTCCTCCCACGCTGCGAAACAGTAAGGTCTCCCAGACGGCCTGGCGCTCACT
GTCTGTGATCTCCCCCAGGTGCCAGCTTTCAAAATGAAAGCTGGGAGCGGGAGCCAGTCTGGTCGGGAAAGCGCGGGAGATTCGAAATCCAAAAAGTGAT
CGGCATAGAGGGGGTATTGCTTTGGGTAGGCTGTAATGTAATTTAAAATGGTTATCTTTTTCAGAGCGGAGGTAGTATTCAGACAATCGTTAAAAATCAA
ATACTACTACGTAGTACGTAGTACTATCTACGTAGTAGTATCTTTTGTGCGCAGGTGTGATACATGTATTCTTTTTCGGGCTGTACCTCGAGTACGTATC
GTTTCCTTCAATATTACTACGATGTATTAATAGTATTATTAATGCTAGTAAAACAGTGCTAACGTTGCTTGAAGTACACGGTAGTTAGTGGACCAACTAC
CGTGTACTTCAAGCAACGTTAGCTACGCGATCGCATTCTAGACATGCAACGTTATAATTGCGACTCATTTAACCGCTTGATGCAATTCATGCTCTGTGCT
CCACGCACGGCGCCGGCACGTTCTACGTAGGAGCTCCACACTGATCGACGCTATGTCCTTCGCCGTACTAAGGCCCGACAGTACGCCCCTCCCCACTCTT
ACTTGCATGTTAGTACTGCACCGACACGTCCCATAGTTCCCAGCCCCTGACGAGCGGGTTAAAGTTTAAATATTCCCAGATCATACTAGTACATGTAATA
CCTTAATATTAATCTCTTAATTTTTTTACAAGTGTTAAAAT