Description :
From Genome Similarity Track
Location :
scaffold_64:149882- 151984
Sequence
2102 bases(100 bases per row)
AGCTTCCGCCTACCAAATCATTGACATGCCTTAGTAACGAAACATGCCTCTTGCATTCTTCATGACAGTGCGATTCATCTTTTCCGTTACACCGTTTTGT
TGGGGGCTACAAGGTCCAGTCCGCTGATACATGATTCCATCTCGAAAGCACATAGCTGTGACCTTCTTGTTTACGAATTCCATTTCATTGTCAAAGCAAA
TGCATTAAATTTGCTCTCCCCATCTCTTTTTATAAAACGTTTTATATTCGGTTAGTTTTGCGGGGATCTCGCTATTCCTCTTCAGGAAGTAAGTAATAAC
GAAACGTGAGAAATCATCACAAATAATAGTACATATCTTGCTACTCCATTTGATACCGTTTGCATGGGCCCCATCACGTCCGTGTGAATTAACTCCAAAA
CACGCAGTGTCTTTAATATTAATTGTAATGGAAACGGTGATACGGTCTGCTTACCCTTCATGCATCCACTGCACATAGTCTTAATACCACGGCATAAAGA
TTGCATACCTTTCGTGACATGTTGAGTGGCCATACCGCTCTCGCTTAAACGTCCCATGCGCGTGCGCCACAGCTCCCACTGACTGTCAGCAACGGCGTAC
TCCACACAACGCGCTTCTTTAAACTTGCAATCAAGGACGAAAGCTTTGCCGACATTTTCGCCCAGAGCTAAAGTTTTGTTCTTTATCATGATAACGAAAT
CCACGTTCTGCAAGTTTTCCAACCGCCTATCGAGTCCTGGAATGCACTTAACATCCAGCATCCGGATGTGCTTACCGTCCATTCCAGTCAGCTTTACAGT
TACCAACTACACGCAATTTCTTTACGTTTGCATTGGTCACATAGATGCCCAAGATCGTAGCATCAAAATCTCTACATGATATGGTGTCATATAAGATGAC
GCACTGCTATCGATCAGGCATCCATTAATCTGATTGTCGCCAACACCGAATACCGTCTTTATTAATGCCTTTGGGGAGTTTCGCTTCATGTGTCCTACTC
GATAACACTCTAAGCACTCTCCCTAGAAGCCACCATTACTCTTCCTTAAACTAAAATCTTTTCGTACATGTCCACGATATGTTACAAACCGCCCACCGCC
TTCGTGAACAGGAAACACTTTCTCCGTCGCCTCCTTCTTTTCCAAACGCTAATGGTCCTTCGACAGCTTTTCTTTGACCTCGATTAGCGTGATGTCTTTG
GGGTTTTTCACAATTGACACAATTAGCTCATAATAGTCGGGAGGCTACTCAGCAGTACCACTAGCTGTCGCGATATGTCAACAGGCCCTCAAGATGACTG
AAGTCCAACAACATATTTGTTAAACGCATCCAAATGCTTGGACATGGTTGAGCCGCTCAACATCTTAAACTCATGCAGGCGGCGCGTCATCTCGACACGG
TTTGGAATCGTGGTAGGATTGTAAAATTCTCGTTGAATGCTCCAAGCGTGCTTAGCCGTCGAGGCAGACCGAATCTTGGTCTGGTGCTGTAGCTCGATAC
CCTGAGCGATGATCCCCAGCGCCTTGGTGTCGTTACCACTATGCTACATCTAAGTCTATCCGTCTAGATTATTTTAGAAGCTTTCGCAAGCAGCCTGATG
TATCTAGATCAATGagcgactaccattatgtaCGTAATCAATATCCGTAATCATAATAATAACTGTAAACAACACCGTAGTACTTATGACGTCATCGGCG
CACATTCTGCGGTACATCTCAACAGTTAACGCGGTTAGCAATCCCTTGAAAGCGTTGTTACGGCGTGATGATATCAACAATGATGGgactcttgcgcttg
caaaTAGAGAAAGCTGAGTCTCGTGAGCCAATTTTGCCTCGACATCAATGCGTTAGACATTATTGTGAATTCAACGGCGAGTTGTCGCATCACTTTCAGC
CGATGTAGCGTAAACAGCGCTTTCCTAGTAAATTGATGCTATTTAGATATACTTCGACGCTTGTACtacaaaatgtcgtcaaactaCGAAATTAAATAGT
ACATTTACGTTTCTTGAGCCCCATCCATCATCATAGGAATCACCGCCACGAGCAATTTTTTGTCGGTTTAAACCGTTGTTACGGATTACAATGTTGTCAA
CA