Description :
From Genome Similarity Track
Location :
Scaffold_401:14986- 17325
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_401-fgenesh-gene-0.3S-phase kinase-associated protein 1A
Pytiw_DAOMBR242034maker-piw_contig_401-snap-gene-0.13Dual specificity protein phosphatase

Sequence
2339 bases(100 bases per row)
CTTGGCGCATGAGAGATCCAGCAGACTTTTGATGTCAAGGTAGTTGGCCGCGAGGATGAGCTCGAAGAGCAGCTCCTGGTCCTCCTTGACCTCGACGAAG
TCGGCGTACCAGTCCGACACGGCGTCGCGCAGGTCGTTGCTCTTGAGCGGCTTCTCGAGCTCAGGCATCGGGTTCGCCGCGTGGTGCGTGCAGAACTGCA
CGACCTTCTCCAGCACGTGGCTCTTGACGTTGGGCAGCGGCACCTCCTGCGGCTCGGCGTCGTCGCCCTCGGCCTCGTCGGCCACCAGCGTGCTCACGAG
CTTGCTCAGCGACGCGACGCCGGCGTCCAGATCGAAGCTCTTGCCGTCCATGGACACGAGCTTGACGACGCGACCGGCGAGCGCGGTGGTGGCAGGGGCG
GCGCTCATACTGACCGGTGCTGGATTGACGAGGGGGACTGAGGGGCTTCTTGGCTCGGGCTGCTCGTGGCGCTGCGGATTTTCGAATGAGCTGTTGGGTG
CGCTAGTTCCTTCCAAGAAATAGGGAAATAGGATGACCATCACTCATAATAGGACTGGGTTATGATTGTGGGTTTTGTATGAATTTTCCAGATGGCTCGC
GTGAGTGATGGACGGATCTCGTTAATTTAGGATGAAATGGGAGCTGCCGCGTTTCTATTGGCCCATGGAAAATGATTTTGTTTGGGACTTTGGGGTGAGG
TGCGGAATTGAAAAAAATGGAGGCTTGTAGTGGCTCACTACATTACCATGGTTGTTGAAAGAAATGACCTTCATTGACTTTGCATTCTACAGCGAACTCT
ATCCAGGACATACTAGTTCGAATGCAGTGGTCTGTGTTCGGGTTGCACATATACGAAAGTGTATCCTTGGCCAAACACCTTTGCCAATTCCTACGGTAAA
TTAGGGAGATCCCTAAAAAGAATTAAATTTGAAAAATCTGAAAAAAATTAAACTCGTGTTTGTGACATGTCACTATCGCATTTAGTTTATATTTTCGCAA
CTTTTATCTAGTAATAAGACTTAGAGAAGAAAAGACTGAAATTTAGCACCTGTCCATAGAATGAGGACGCAGTGACCACCACACATGGACACCACCTTCA
GAAAATTGATATCCAGGCTTTGTTTCATATATATGAGATTATCAATAATAATGCAAGGCTGTTGCTCTTCTCATGCCCGCCCGCCTCTCTCTACCAGAAC
ATGCTGCTGCTGGGCACGGACGCCTTGTTGCGGCTGTAGCGCATGTACTTCTGGTTGTTGAGCTTGTCGCCCTGACTCTTGTCGTAGCCCACGCTGCCAT
TGCCATTGCCACTGAGCGACAGCGCCTTGGTGCCGGCGACGAGGCCGCTGGTGGGTGTGCGCGTGGGGCTGGCCAGCGGCAGGATGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCAGCCGCTTTGGTCGCCGCGGCGGACGGGTTGAGCGC
CCACATTTTGGCCTCGATAGCCTCCATAAACTGCTGCTGCGGGCCAATGACGCTCCCCGGGCGACAGAGCCGCAGCCAGCCGATGAGCTCGTGGGCCGAG
AAGAGGTCGTGCTTCATCATGTAGGCGCCGATGCACGTGCCCGTGCGCCCGAGGCCAGCCTTGCAGTGCACGGCCACGGCGCCAGGCGTCTTCTCGCAGG
CCTCGAGGAACCGCATGAGCACGCTCAGGGGCGCGTTCGTGCCGTCCGGGTAGATCAGGTCGAGGTGGTCGATGCCGGCCGCCAGGAACTTCTTCTCGTC
GTACTGCTTGTCGTTCAGGCGCACCACGAGCGTCACATTGCGCTTCTTGAAGTACGGTATGTAGTGCTCGGGCGTGAGCATCACGTGGCCCTGCGGCGTG
CGCTGGTAGTGCGCGTGCGGGCCGGCGAAGGCAAGGAACTTGGGCGAGACCCACGTGAGGTCGCCGTTCTCCACGCGCTCAAAGTGCTGGTACTCGTGCA
GGTCGAAGGTCTTGGGAGACACGTAGCTCGCCTGCAGCGCGCGCTCGAGGCCCTGCAGGCAGTCCAGCACCGTGAGCTGGAAGCTGCACACGGACGGCGT
GGCGTCGTGGAACGGCGGGAAGCGCAGACGCTCGAAGGG