Description :
From Genome Similarity Track
Location :
Scaffold_212:14986- 16037
Sequence
1051 bases(100 bases per row)
TGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGCGTTTAAAGATTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTG
CATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAA
TCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAA
GTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGGCAAAGCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGAT
GTTGGCAGTCCATGCGTATGGACTTTGGGTTTGACCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGTAAGAGGGC
TCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAACCGTC
TCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGCGTGCTCGACACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCG
ATGGTCAAACCGAACGCATGAATCGCGTTGTGGAGGATATCCTCCTAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGA
GTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAGCGGCTTGGTTAACCCTCGCGTCCCACCGACGCCCCCACGCAGT
GGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATATCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAA
GCGTAATGCGTCAAGTACGCGACGCTATGACTGAAAGCCAAGATATGCAAA