Description :
From Genome Similarity Track
Location :
contig_62:149841- 152595
Transcript NameFunction/comments
g10911.t1POM74341.1 Hypothetical protein PHPALM_8716 [Phytophthora palmivora var. palmivora

Sequence
2754 bases(100 bases per row)
CGATTTCCCGCGCCTTAATGGGCGGAATTTCGTCATCTGGAAGACTCGAGTGACCGCCGCCCTTGAAGGCAAGAATCTGATCGGCTTCGTCACCGAAGCC
GACTACGCGGGCGACGAGGACTACGACTTCTCCTCCGATGAAGACCTCAACCCGGCACTGGCCGACATGGGGGACATTGAGGCCGCACTAGATGCCGTTG
GGGCGCCCAAAGCCACCGACATGGAGGACTCCTCATCGAGTGAGTCCTCTTCCGACTCAAGTTCGGAGGCTGCCACCGCTGGAGACGACGGCGACGTGGA
AATGGGGCAGGTACAACCACCCTTGATCCAGTCATTCACCGCTAAAAAGCGTGATGATCTGAAGCGAGCTGAGAAGCTAAAGGCCAAGAGCCTGAAGCTG
AGCTCGAGGAAACTACGGCTCGATGAAGCAAAGGCTAAAGCCTTCCTCATCAAAACCATCGATGATCAACACGTTCTCATGGTGAAGGACAAGACTACGG
CGTACGAAATCTTTCAAACGCTCTGTAGCAAGTACGAAGGTGCTGCCATCCACGGTGACCCGTACTACATCCAGTCGTACCTGATGGCCCTCAAATACGA
GGAGGGATCCGACCTCATGGCTTTCATCATCGACTTGGAAGAATCCATGAAGGCAGCCGCGGAAGCCACGAACAGTGTGCTGAGCGACGAGCAAAAATCG
CTCTATCTGTATCACTCTCTCCCAACGGAGTGGAAGCCTGAACTAGCAGTCTGGAAAGGCAGTCGGAAATTCATTCCGTACGAAGACCTGAAACGGCACA
TCGAGACCAAGGTCCAGAATGAGCTAGCGCGCAATCGCTACGTCCTCAGACAAGGAACCCCAGAGTCTAAGGAAACACGAGCTGAGAGAGCTCTTCGAGC
CACGGCACCAATTCCGATGCCAGCGGATCTCCAAATCCCCGCCAAGATGGAGACAGCTCTCGTGGCTTCATTGAAGTGCACGTACTGCCAGCGTGACAAC
CACGACACGGTCGACTGCTACATCCTGCAGCGCCACCTACGTGATGGCCAAATCAAGGCTGGTACGGTTCTGCCTGCCAACTTTAAGCTCAAGGCACCAC
AAGGCACGCAAAGCCATCATCCTTACAAGGGCAACTACAAGGGAAACCGTGGCAACAACTCGTGGACAAACTATCATGGTCGTGGAAACAACAATCGCGC
TCCTAATGGAAAACGCCAAGATCGCCGTGGAAATCACAGCCGCAACAACCAAGGCAAGCAAAACGAATTTCACGGCCGACGCAACCAAGACGCCCATGGA
TCGGACAACAACGAGTATGGCATAATTGCTATTACAACGCTCGATTGTTCCCCCAAAACTGTGGAAGTGAGTCTCACTGCTCATGTCGGACACCATGATC
CATCATGGACGATCGATTCCGGCTGCACTCGCCACGTCACGTCCAACAGAGAATGGTTTGTGACCCTAAAACCGACCGCGGGTAAGTCCATCACGGTGGG
GGGCAATCACCAGATTCCCATTGCAGGAACAGGTGACGTGAAGCTATCCATCAAAGATACGAAGGGAAGAGACAGAGTCATTACCCTGATCAACGTGCTG
TACGCACCTGACCTCAAGTTTAACTTGCTCTCAGTTCGTCAAGCTGTCGAAACGGACTACAAGATCAATTTCCCGAACGCCAAGAAATGCGTCCTGTTCT
ACGACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAATGGCACTCGCCTCTACCAATTCGAAGCTCGCCCGGTGAACACCGACCACGTAGCCCATGTGGC
CAAATCTGGTACGTCCGATAATATTTTACTCTGGCACAAACGAATGGGCCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCAGACGTTGTCACA
GACATGGGGATGTCGAAATTCGACTCAAGCAAAGACTACTTTTGCTCCTCATGCACATACGCTAAAGCACATCGTAACCCATTCAATAAACGTACTGTTG
AAAGGGCAAAATTCCCTCTTGAAAAGGTTCACACAGATATGGCTGGACCCCTTCCTGTGCCAACACTATCAGGATGTCAATATTTCTTGACCTTTATTGA
TGACTACTCGCGCTATATGTTTATCTACGTTATCAGGCGCAAGTCAGACCTTTATGGCTGCTACGAGGACTTCAGAAAGAAAGCACAGAACATGTTTCGC
GCTGATGTGGGTCACTTAGCATACGATGCTAATATGCACGATGAAGAAATCCGGAACCTCCAAAGTGACAACGCTCGTGAATATGAAAAACTCGGCAGAA
TTATCTTCGAAAAATATAACACCCACGCACAGTTCACTAATGCGTACACACCACAACAGAATGGCGTGGCAGAGAGGCGTATGCGCACACTCCTTGAAAG
AACGCGAGCTTTTCTAATTGACGGAGATCTTGATCAACTCCTTTGGGGCGAATGCATCACCCACGTCGCTGATCTCCTCAACATGACCCCGAGCTCGGTC
ACAAACAACGTTACTCCCCATGAAAAATGGTTCAAAAAGAAACCATCAGCACACTACATTAAGGTTTTTGGCTGCACGGCATACGCTCACGTCCCGGAAC
TATACCGCAACAAACTCGAAAAACGGGCTAGAAAATGCATGTATCTCGGAATTCCATCCAACAAGAAGGGCTACAGGCTCTTAGATACGACAGAGAATCG
CATCATTTACAGTCGTGATGTTACCTTCCGCGAACATGAATTCCCCACGCTGGA