Description :
From Genome Similarity Track
Location :
contig_62:149829- 152582
Transcript NameFunction/comments
g11409.t1hypothetical protein
g11410.t1hypothetical protein

Sequence
2753 bases(100 bases per row)
CGATTTCCCGCGCCTTAATGGGCGGAATTTCGTCATCTGGAAGACTCGAGTGACCGCCGCCCTTGAAGGCAAGAATCTGATCGGCTTCGTCACCGAAGCC
GACTACGCGGGCGACGAGGACTACGACTTCTCCTCCGATGAAGACCTCAACCCGGCACTGGCCGACATGGGGGACATTGAGGCCGCACTAGATGCCGTTG
GGGCGCCCAAAGCCACCGACATGGAGGACTCCTCATCGAGTGAGTCCTCTTCCGACTCAAGTTCGGAGGCTGCCACCGCTGGAGACGACGGCGACGTGGA
AATGGGGCAGGTACAACCACCCTTGATCCAGTCATTCACCGCTAAAAAGCGTGATGATCTGAAGCGAGCTGAGAAGCTAAAGGCCAAGAGCCTGAAGCTG
AGCTCGAGGAAACTACGGCTCGATGAAGCAAAGGCTAAAGCCTTCCTCATCAAAACCATCGATGATCAACACGTTCTCATGGTGAAGGACAAGACTACGG
CGTACGAAATCTTTCAAACGCTCTGTAGCAAGTACGAAGGTGCTGCCATCCACGGTGACCCGTACTACATCCAGTCGTACCTGATGGCCCTCAAATACGA
GGAGGGATCCGACCTCATGGCTTTCATCATCGACTTGGAAGAATCCATGAAGGCAGCCGCGGAAGCCACGAACAGTGTGCTGAGCGACGAGCAAAAATCG
CTCTATCTGTATCACTCTCTCCAACGGAGTGGAAGCCTGAACTAGCAGTCTGGAAAGGCAGTCGGAAATTCATTCCGTACGAAGACCTGAAACGGCACAT
CGAGACCAAGGTCCAGAATGAGCTAGCGCGCAATCGCTACGTCCTCAGACAAGGAACCCCAGAGTCTAAGGAAACACGAGCTGAGAGAGCTCTTCGAGCC
ACGGCACCAATTCCGATGCCAGCGGATCTCCAAATCCCCGCCAAGATGGAGACAGCTCTCGTGGCTTCATTGAAGTGCACGTACTGCCAGCGTGACAACC
ACGACACGGTCGACTGCTACATCCTGCAGCGCCACCTACGTGATGGCCAAATCAAGGCTGGTACGGTTCTGCCTGCCAACTTTAAGCTCAAGGCACCACA
AGGCACGCAAAGCCATCATCCTTACAAGGGCAACTACAAGGGAAACCGTGGCAACAACTCGTGGACAAACTATCATGGTCGTGGAAACAACAATCGCGCT
CCTAATGGAAAACGCCAAGATCGCCGTGGAAATCACAGCCGCAACAACCAAGGCAAGCAAAACGAATTTCACGGCCGACGCAACCAAGACGCCCATGGAT
CGGACAACAACGAGTATGGCATAATTGCTATTACAACGCTCGATTGTTCCCCCAAAACTGTGGAAGTGAGTCTCACTGCTCATGTCGGACACCATGATCC
ATCATGGACGATCGATTCCGGCTGCACTCGCCACGTCACGTCCAACAGAGAATGGTTTGTGACCCTAAAACCGACCGCGGGTAAGTCCATCACGGTGGGG
GGCAATCACCAGATTCCCATTGCAGGAACAGGTGACGTGAAGCTATCCATCAAAGATACGAAGGGAAGAGACAGAGTCATTACCCTGATCAACGTGCTGT
ACGCACCTGACCTCAAGTTTAACTTGCTCTCAGTTCGTCAAGCTGTCGAAACGGACTACAAGATCAATTTCCCGAACGCCAAGAAATGCGTCCTGTTCTA
CGACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAATGGCACTCGCCTCTACCAATTCGAAGCTCGCCCGGTGAACACCGACCACGTAGCCCATGTGGCC
AAATCTGGTACGTCCGATAATATTTTACTCTGGCACAAACGAATGGGCCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCAGACGTTGTCACAG
ACATGGGGATGTCGAAATTCGACTCAAGCAAAGACTACTTTTGCTCCTCATGCACATACGCTAAAGCACATCGTAACCCATTCAATAAACGTACTGTTGA
AAGGGCAAAATTCCCTCTTGAAAAGGTTCACACAGATATGGCTGGACCCCTTCCTGTGCCAACACTATCAGGATGTCAATATTTCTTGACCTTTATTGAT
GACTACTCGCGCTATATGTTTATCTACGTTATCAGGCGCAAGTCAGACCTTTATGGCTGCTACGAGGACTTCAGAAAGAAAGCACAGAACATGTTTCGCG
CTGATGTGGGTCACTTAGCATACGATGCTAATATGCACGATGAAGAAATCCGGAACCTCCAAAGTGACAACGCTCGTGAATATGAAAAACTCGGCAGAAT
TATCTTCGAAAAATATAACACCCACGCACAGTTCACTAATGCGTACACACCACAACAGAATGGCGTGGCAGAGAGGCGTATGCGCACACTCCTTGAAAGA
ACGCGAGCTTTTCTAATTGACGGAGATCTTGATCAACTCCTTTGGGGCGAATGCATCACCCACGTCGCTGATCTCCTCAACATGACCCCGAGCTCGGTCA
CAAACAACGTTACTCCCCATGAAAAATGGTTCAAAAAGAAACCATCAGCACACTACATTAAGGTTTTTGGCTGCACGGCATACGCTCACGTCCCGGAACT
ATACCGCAACAAACTCGAAAAACGGGCTAGAAAATGCATGTATCTCGGAATTCCATCCAACAAGAAGGGCTACAGGCTCTTAGATACGACAGAGAATCGC
ATCATTTACAGTCGTGATGTTACCTTCCGCGAACATGAATTCCCCACGCTGGA