Description :
From Genome Similarity Track
Location :
scaffold_76:149817- 152257
Transcript NameFunction/comments
g7379.t1 hypothetical protein PHYSODRAFT_255250
g7380.t1 hypothetical protein PHYSODRAFT_477036

Sequence
2440 bases(100 bases per row)
CACTGCCGGGCTTGGGCGAAGTGTGGATGTCGTAGCCTTGCTCGTAGTCCTTCATCTTCGACGCGAAGTATCGACAACGGGATTGACAGTGTTTGAGTCC
ACCGGGGGAAATTGGAGAATGACAATCGGGACCAGCTTGTGAGGTCGCTGACATCGCTGAGCAGGACCGCCCTGTTAAACCTCGTTCCTGGATGGTAGAA
GCACAAGTTGAAGTGGAAGACAGATCCCGCTTGAGCTCCGCGTGACCGCAGATTAACGCGACTGACGAACACATTGATGAGTGGTTCCTCTTGAAACGAG
ACCTCGTTCACCAGTCGAAATAGTTGAGCTGGCCTCGGTGTTAAGGTGGTACATGTAGCAGTTGCAGTTGCAGTCGTCGAGTTGACTTAAGTGAGAATTA
GTGCTGATACAACTTGCTGCATATTGTGCAAGTCGAGACAACACAAGCCGCGCCTCCAATGTCCTGGACCCTTGTCAGGAGTCGTAGAGTCTTCTGGAAA
TCTAAACAATCGCCTATCACTGTTGTGAAGAGACGCTCCATATCCAAAAAGTGAGCTGCTAATCACCATGGCGTTCCGCTGCGCTGGGAGTCCGCTAGAC
GAAATGAAGAGGCTGGAGAAGTTGCGTGAGCAAGACCCGGAGTCTGCAGCCAACTTGGTGGCCAACGGGAAGCTCCTCGTCGATTTTACCCACGACGGGA
ATCTGCGTGCACTTCAATGTGCAGCTGAGCAGCTAGAGGAGGTACGACGACCTGCAACCACTTTCTTCCTTTTGTTTGACGCGGATCATGTCTTGACTGA
TACTCACTCATGACAGGGGCAAGTGCTCATGTTTTATGTCGTGCGGATGTTCCGCGAGGCCTGCTCGACGAGGAGACTGGACATCCTGCGATTCCTGCTG
CTCAATGGATTCGACCTCCAGCAAAGTTACACGCGAGATGTCCTGCACGGGGTCATTGAGAGTATTGACAGTCCGCAAAGAGCTGATGCTGTACAACCCC
TCATTCGGTTTCTCCTGGACGCTGGCGTCGACGTCAATTGGCAGAGGAAGTCCGACCTGTACACGGCACTACACGTCGCGTGCTGCAAGAACTTGTACCC
CATCGTGTACTTGCTCGTTCTGTACGGCGCCGACGTGAATGCCATCGCTGCGGTGGGTATTAAAGTGATACAAATTGAGTGCAAATATCGCTAGAAATGC
TAACGCTGCTTTTGACTGCGATGCTGCAGGATGATGCCATGCCGCTCGCGTGTGCAAACAAAATTGGCGACACGAGCACTTTATCAGAAACTGAACAATC
GCAGAAGGAAATGCTCGTGTCCTTTTTGGTGGAAAACCAAGCACGAGAGACCTGGAGAAGGCAACCACGTCGAGTTACTCCAGCAGCGTCGATGAGTGCG
AGCTCGCCCAGCCCAGAAGCTGGTGAATCTGCAGTAAGTCCAGTCAAACGACCGATCTTGAGCTTTTCGAGTAGTTTCGGTATCCACTGTAGCATTGACG
AACCGACAGACAACCAGCCCCAGGAAGGTCTCCGATTTGACACATCGGACACCTCCGAAAGCCTGTAGGCGTTTGCAATTAGGTGGTTTCACCAGCACCC
GAGAAATGAGATGCAACAGAAACAAAAATACAAACTTGACTTGTTCAAGCTGTCCTTTAACCTGTGTCGGTCTCTTGCTTTTCATAGCTCAGCATTCTTT
GCATCTGCGCGGCTTCATCGCTAGAACTTCTTACGAACCGCGGCATCACACATGTCGTGCAGCCTCATTGAGGCCAAGTTCCAGGTGCTGGACCGCACCA
TCAGGATGTTGTCCAAGTCCAAAAGCTTGCGCACGCCGAAAGTCGCGTCGTCCGAGCAGCTTCGCGATCTTGTAGAAACCCAGAAGCCGACCTCTCTTCT
GCCGACGCTAAACGCTGTGAAGGGCGTAGTGGTGACACGAAACAACCAGACGTACCCGACCGGTGAGAAGACAAGTCGATCGCAGCCGAGTACTGCGCGC
GAAGAGAAATCTGAAAAGAGATCAGGACACTCACCACCACGCCCAAGCACTGGGAGGAGAGATCCATACGAAAGCTCGACCGAACTGCTCCCAGACAAGT
GGGTCGACCCAAAACAACGGCGAGCAGAGCAGCTTCTGCAGGAGACTTGGCATGTACGTCTCGGATTAGCTATCAGAGCGATACTATCACCTAACTGTAT
GGTTTGCACGGCAGGAAATCGAGTCTGCTGTAAACTGGGGTCAAGAATTGGGCTCTCCCACTCGAGAGGTAGGCTTGCGGTTGGCAGTTCGAAGTCATGT
GATCCTGACTAATTGAACGGCGATGTCATGCTCTAGGCGCTTCGGTCGAAGTTGCTCAACGAAAGTGTACAAGATGATCGCCAAGAGCAAGAGTCGATAT
CAAGCCAGCGTCAACTACTAGAGCAATACATGGATAACCA