Description :
From Genome Similarity Track
Location :
Scaffold_36:14980- 21071
Transcript NameFunction/comments
Phyta_totarag1747hypothetical protein PHYSODRAFT_552991
Phyta_totarag1748conserved hypothetical protein

Sequence
6091 bases(100 bases per row)
AGATGCCGACCGATATTGAGTGCATCGTGGACCGTAAGCtcatcaagcagcgcgtgcacTACTTTGTGGTCTGGAAGGGCTTTGGAGAGGAGAACAACAC
CTGGTACAGTCACCAACAAGTCACACGTAGCATCCCACCCATCTAAACGCTTGCATCACTAACGTATTATTATATTTGTACTATTATCTGTACTACTATG
CAGGGAGAGCCGTATCGACCTCATGGCCGATGGCTACTCGAACGTCATCAAGCACTTCGAAGAGCGTACGTGGCGGTAGCTTTTCGTGGCATAATGCTCA
TCGCTAACTATATTTTAATTTATTATTTGTTGCAGAACGTAAGGAGTCGGAAGGTCCGACGCCTCGCGGCCGTAGCCCCGGACGCTCAACGTCCAAGAGC
CCGCGCAAGAGCAAGATCCCGGGACATGAACCTGGTCGTTCGAGGGGACGTCGCAGTCGCTCGCGCAGCGCCTCGGTGAGCAGGAAGTTGCGTGtgagca
acaacgacgacgagaagagcaacaaggacaaggagaacaCCAGGTCTTCTTCCAGAACGACCCCGCGGCGACGCAAGAGTttgagcaacaacaacgagaA
CAACGACGAGGCCAATGTTGTAGTGAAGGAGACGATACCTAGACGTCGATCGACCCGGAAACACGCTAACGTTACGACGGAGACGCCGCCATCGACCCAG
TTTGTGTCTCGCctggacaagcagaaggcTGACCCTACCActgatgaggaggacgactcgGTTCTGCTGCGGTCAACTATTGCGGCGCTGGCCCCGCAGG
TGCGTGAGATGGCTCCTCCTACCCCGTTGGCGGTGGAAACGGATGCGCACAAGAAGCCGGTGACGCTGTCgtacgaggaggacgaggagtcgggggtgct
gttgaagacaCAGAATAGTAAGGAAGCCGCATCCTCGAAGATCAGCCCCACGAGTAGCGCTGTTCACGAGCACGCTGGCCCGGTGCAAGACGATTTGATT
gccaaggtggtggagagtGGTTATCTGGCGTCGTTCATGACTGTAGCGGCTGTAGTAGGCTCTCTCATGGTGAgtcagctgctgcctcgTGATGCTGAGG
AGGGTACCGACCTGTGGCGGAGGTGGCTATCGTTCCTCACGCCCGTtgtggcgctgcttcttTTCTTCCACCAGAAGGATGCGCGCGCTTCGGCAAAGTG
GGTGGCCACTGGTCTGGcatggcgtgctgctgcggagctgctgctgttgatcgGTGCCACGCCGCGTGAATTCGAGACGATGGTTGCTGGCTCAGCTATT
CTCGCTAATGTTTCACTGCTCGTTGCTCTTGTGTCCATTCTTCGCAACGGTGAGCACGAGCAGTCCAAGGCTacgcttgtgctgctggcagtggGAGCTC
TGACGCTTTTCCTTTCGGACAGGTAAGCTGTGATTTGGGAACTTGCGTGTTCTGTCTTTGTTTTGAGCTCTAATTTGGCCTACTTGTTGTTTATCAGCTG
GGTGATCTCCACTGAGAACTCAGAGTTGGAGTCTCGTGTGATTCTTATGTCATTGGCTGTTGTAAGTATTACTACTTCAAACTGGTTTCCGATTCCGAGG
TGATGAATTGTATGACTAACTTGTGTACTGGTTGGTATCTTCCTTTGGATGCTCAGCTGACGATCGCACTGTCGCCAATGCCGACGAAATCGTCTGAGGA
TGAAGATTAGGATAGGGCGCCTCAGGCCCAACCGCACGACGCTGTAATTAGGAGTTTCTTGTTTTTTCGCCGACTTCATTCGGAGGCAGCATTGTCGCTG
CTAAATGAATTTTATGATCTCCGCTGTTGCCGGCTGGCTGTGTTAGACTCCATCATCTTTCCTTAGTCGCAACGATCTGTATTCCTCGATAGAGCGAGAA
ATAGTACCGTAGCGGTAAGGCAATCATGTGCCCCTAAAATTCTGTTTGTATTTTCAAACGACCCGCAAGTCCGTGTGCAGGTAGATTTACTGTAGCGCCA
AGTGCAACGTCTTGATCAGCAGCTGTTGGCTTTGGACGCTTACGACTGAGTCGACATCACCCTCGCGGTGCACCAGCTCTCGAATAACCTCAATCGTCAG
TGCTGACGTCGTATGGGCGCCATGCATCCGGTGCCCGGGTTGTGATGCGTACTCCTTCATAGCCTTGTAGAGTAGGGTTTGACGCATCAGCGACTCTAAA
TTCTCCTCGTTCACACCCGCCGCCGATTCGGCCGCAAGGTTGTCCCATAGTTCACCGTCATCGACAATGCAGGAACGCCAAACACCCGCACGCATCTCCT
CGCACTCCTCAGTCAGCGGGTCAGTTGCTAGTGTCTCTAACGCCTCGAGCGCCATCAAGAAAATGTTGGTTCTGTTACACAATGAAAACATAATCGATAA
TGAGTAACACACCTTCAGCCAGATATAAAATGACAAACTAACGGTACCTCATGGGGTCGTCTTTCTCGGCCGAGAGGGCTGATGTCAAGCACGCGTGGAC
CAAATCTTCGGGTGAAAGCGGCTGTGGATTGATGGGCTCCTTCAAAGGCAACTGCAGTAACAGCTCCTGGAGTTTTCCGCGGACAAGCTGCGAAATACAA
GCACGGAGACATCGTGAATACTTTACTTGAGCAACAACATTACAAACCGCATAACGTACCTCGTGGTTGATCTCCTGAATCCGTTCAGGGTGAGACAGGC
TGGGGGATGCAAAGGCAGCGATTTTGGCAATGCTAGCCATCGTCTTGCGCTTCGGCAACGATCGCTGCTCCCCCTTCGCTTCGCGCAATGCAAGAGTCGC
CACCTGGTCATATCGCTCGATTGAGACTGCTGTCAGCCAGCGGTACTTCCTCAGGTGGTCACGGCTCTTCATGAACTTGTGCAGTGACGGCGCAAAAATC
TGCGAGTGGGCCAGTAGATACGCCATCATGGTCGGAGAAGATGCGCTAGCTTCTTGATTGCCGTGCGCCCAGGGGTCCCGAACCTCACCGTTATACCAGC
GGAAAATAAAGTTATCAAAACCCTCGTGTTTCTTGCAGTACGACTCCAGCCTCTTCGATGCGGGGCTCTTCGGTAGTTTGCCTAGGACACAATCCAGTTT
GGACAGGCTCTCCGAGTCTTCAACGAAAACGAGATAAACCATGCCTTCAAAGTACGAATACTTCTCGCAAAGCTCTACGCATTGGCTGAACAGATCCACT
CGTTTCCGCATGACAGTACCATCCAGGTCGAAGTCAACTGCGACGTCACTTTCTTGGGACGGTGTCTGCGTCGCGATGTAAACAAGAGGATTTAGCGTCA
CACGCTTCGTAAATGTTTcctccttgcgcagctcaTCTGCTTCCTCGTTTAAAGCAAGGGAGATAAACCGAGCGTAGTCGTCCAGCAAAACGGTTCCTAG
TCTCCGAATCTGATCCGTGAGCTCGAACACCTCGTCGTACTGCCAACGAATCTGCTTGTCGAATGATCCCGACTGCGAGTATCCCGCAAGAATAGACAGA
CGGGAAATTTGATTAGCCAAAACTTCTCGCACTTCGCGCGTGAATGCCCAGCTTCCAGTTGGCGCGAAACTGGCAGTAGAGCTTTGCACAGGAGTGCAGA
GCATACTCAGCATGGCACAACCACTTTCTAGCAGGGCATAAAGATATGTCGGGTCGCTCTCGCCAATAGAGGTCGCCAGATACTGAACTTCGTCACCCAA
AAGCTGGAAAAGCTCCGCAATCTTGCTCACTTCGCAATAGAAAACATCAAAGGAATTGTAACccgcaagacgaagctgctctttTTGGTAGCCGCGTTTC
TCGACTGTTTTCTCAATCGCATGCAGAAGGAATTTCCCGGTTAACCGGCGTTGAATCTTTTGCACCTCCGATGAAACCTCATCCTCTGTAGAATTCGAAG
ACAGTATCGACGCCTGGAACTTGCTTAGAGCAATTGCAGCTTGCAGCTTCTCTTCATTCTCCGTCAAATAGCGCTTGAGTTCGCTGGAGTTTTCGATAAA
CTCCCAGACGGACACACAAcggcgctgcaggaactcCATAAACGCTATGTGGCGATTTCTCTTTTCTTCTAATTGGTAGCGCACCAGCTTGGGAGTGACC
GAAGAAATGTCAGATTCACTATTCTGTGCATCAGTCTGGAGTGGGGCATCATCGTTTGCTTCTTTCTCCCAGCGCAGTCCAGATGACGATTTGGCATCCA
TTATCTGGAAatccacagcaacagcagcctcAGCTACAGAACCCACATCCCTCGCACTCACACGCAACGCTGACGCGGAGTTCGGGTCATCGTGAAAGTG
CGTCAAGATCAAACGAACGTAGTCCTCCACAGCTAGGCTCTCGCCCAAAAAGTGAGACGATTCGCTCGTGTAATAACTTGCTTCTTCGCGTCTCCGGCGG
GTCCTCTCCACCGATGCCTCGGACGGAACTGGAGCCGCTAAACGTTCTAATTTCTGCATATCCGAGGCAGTAGCCACACATACTGATCCGCTCGGTGACT
TAACATCTTCTTCCATCAGCAAGAACGAGACCGATCCCTTCACGGCGTTGTTGTCGAACGAACTCTGGTCTACACGAGCACCAAATGCCAGAGCCAGTCG
CCCTTGAGCACCTAGAAGCGGGAACGCTGCCGAACGCACACTAGTTTGCCCAACTTGTGGCAAAAGAATGGTACAAAACTGGATAGGCTGCATCTGCGTC
CACACGAGGTACAGGGCGCCACGCGTGATGGAAAAGCTTTCAACCTGAAAGAATCGGTTGGCGGCCTGCTCATCGAAGGCCGGCTCAAAGTCCAGCATGC
ACACCCACTCCATCTCGGGCGACGCGTCGTCATCCACAGCTCCGAGCGAGAACTGGAACAGCGCGTACTTGACCTTTGCATTTGTGCCAGCTcgcgacga
ggagcagacAAACGCCACCAGCAGAGCGAAACACGTTTCCTGCACGTACGGCATCGAAACAATGTACACCTTGGCCAGGTGAGCGTCAGGGAAGTTGTCA
CTGAAGTAGCTGATCGCCACTCGACTGGCATCAAAATGCCACTGAGAAACACACGAGCAGTCCATCACATCTCCCGTGCTGAAAGAGCGTCGCTCGAGCA
TGCCGTTctggaacagcaccaacataTCCGACGTCTCCTCCACTTctcctccactgctgctcatCGACGTTGCATCTcccatcgacgacgacagtaCCCT
CAGGTACTTGATAGGCTGGTCCACATCCAAttctcctccgtctgctCCAGATCTCGATGCcgtcgaggagaagaaaaaCTGCGACACCGACTTGGTGATC
CCCGACAAGAAACCTGCACTCTGCTTCTCGAAAGCCCGCACACGAATGCGTCGATCTTCCACCGCCACTTCCCACACGTTCCCCTGGTTGCTCCAGCACA
CCAGCCCAGTGGCATCTTCTTGGATCACCTCGTCCTGAGCTCCTTCCTGCGTCGCCACCATAGCCGCATTCGGGTGCGTACTGACTTCTTCATTAACTCC
CAGAGGGATCTGCACACTCAGCGGCACACTCTCATAGGGCAGCTCGATATCTTCCCAAAACAGCACAATGCCGCTCTTGCCCACCACCATGAGACTCAGA
CTCTGGCTGTACAGAGCGAATAAAAATGGGCACAACACTTCGTCGGGTTCCAGTTCATCTGGCAGTTGGAGTGCGATCACTTTGCCCCGGTCTTGTtgcc
acagcagcactttAGTGCGTAGAGGGAACACAAAGTACGGCACCCATTGGCGACCGCTGCGATGACGCGCAGACGGCACCGACGCCCGGCAGCAGCGCAC
TTGGTGACGCTGATGCGTCGGCAGCTGCGGCCACTCCTTGCGCACTTCTTCGAGTACTTGGGGCGGCAGACTGGCGCCCTCCACGATAGTGCAGCTGCGC
GtgtccaccagcagcgacgacgtctCCTCGGCGTCGCCCACGCTCCCCGACCGCGGCGCGTACAGTGCGTCCCAGTGCTCCAGACGCTGCCGCTTGCTGG
CGCTCAGCACGTCGGTGGACAGCAGCCCCGTGCCCACGCGCTTGGAAGGCACCTCCACGAACTTGCGCGCTCGGAACATGCTGGTCGAAAA