Description :
From Genome Similarity Track
Location :
Scaffold_4:149781- 156938
Transcript NameFunction/comments
Phyca_LT153413514protein kinase putative
Phyca_LT153410023250S ribosomal protein L4 putative
Phyca_LT1534559789cytosolic regulator of adenylyl cyclase

Sequence
7157 bases(100 bases per row)
tgatgagaagcaaagctaaggaagatggcgcggcaggagccaactctgcggcttcaatctgtgagctatgcgacctgtacacgcgcaatgacttggacgg
caagtggacggagctcgcggaagtctacgacgtacgatttccacactaaatacaccaccagtgccaacgctaactattttttgtgtagcaacgccgaaat
gttgacaacttccgggagattctggatttgagcgcccctagcgcccgcatgggcgatctcaatggctggcacttagaacgtatggccgttggcgagttcg
aacctggtgctgatgctagtgctagtgacttggcggagatcaagcgcgagagtcgactgatcaaacagacgctgatgaaggtgctggcgaatggccgtga
ctttaaggcacagagagatgagctggaggcggcaatggctaagcaacgagaagcactgaccgtcgagctgactgaagccaaagagttcctgggccaagcg
catttactgaacgcttgtgactccgctgccattgaggttagtgaaccggcacctgttgaggaacgcctgcggtctaccgttaaacacccggagctgtcgc
ctacggttgatctaagcgacgtgccatcgatctaagtatgaaggagggtaagaacattcaaaacagggcggaactccagtgcattcgttcggtgcttcgg
ccacactctatctgtgacttgaattggtcacctcctcccgtctcgcttgccctcctgactttctgatcgtgcccacctgtcgaactgctgctacattcta
gtcgacgtgaagacgctcctcaaggtacttgacggcatccttcgtgatgatcaacaggtccttctgcaggatcgagtagacgttaatcttgttctgcgcg
atcgtgtccacgtgcggaatgttgcgcgtggcaagctgaaagctcgattccacttcctcaccacccacgaacaacgcgtggtcccatccacggccgccca
gcagcttcttcatatctttcgtcttagtaacctgttcgcattaaacaccagtcagcacaaacagctcaactacaaagcgcaactccaaacaatcacatac
gtcaatgtccagcgagtccacaacggcaagctttccttcacggagcttagttgacagcgccacgcgcagtcccatagcgcgcaccttcttgggcaagctg
tacgagaaatcacgcagcacggggccgtgcacgcggtaaccaccacgccactgcggcgcacggatgtcaccgacacgggcacgaccagatcctttctgct
tccacggcttgcgcgtagatccgctgacttcagagcgcgtcttggtcttgttggtgccagcacgacggcacgccagttgccagcgtaccacacgctgcag
gatgtccacacggtcgggagcaccgaagacttctccgtccatagtgacggaaccaagatccttctctccctcagcaagcgacagcagctgcagctccagg
tcgcccgatgaagtcactttgacttgctgcgcagcggcgatcacgcgaggagggggcatgggcttctcctcggctagggacaggttcgacggcatcgtgg
ccgcctgcgtactagctgcacgtgcgagactcgcgcgcggggcggaaacactcagcgccgcaacgccgcgcagcagtcggttcatggacacagtcgccat
cgtctcccttgtaagatgtctgtgcggctctcgatggatggcgttgtgcggtcaattgaaacacccactttaggttattcaaaatatgaaaaacccattt
cacccagattttatcaagttgaaatttcacgtttcactgagatattatttggcgaaaaaagtcagtaggcaccgcggcatcatccccctgcatggcatcg
caacgcagaggctccgccccgcgcggagatggcagtttagccgccatctgtacgctaattgagcgcagcaacctggaccgcaagtccaagcttgacagca
caggccggatctgctacgtgcgtatcaatacaagtctttttatctgcagtttggactaatccactacgttttatatccataggagctgaagaatgacccc
ttactgctagacagctttccaatggagcgtctcatgaaggctatgcgtcgtctggtgtgcgattcggacacatctacacgtgctggagctctgagggctc
ttcgctacgctatcagcagcagcactagcattaaacacctcgtggatctcaatctaccggtatttgtggtacgttcgctggagcgcgagcagaagcacct
ggcagagcgtgtccaagcgctaaaagttgttcggcggatcttggagatcgacgcggcacagatgcccacggggcttgtgtgctcgttgacggctattgca
ggtcataaagacgataatatgcgccgagtctgcttggaaacgctgcgggagcttgcgctgttgaatgtggaagttgtggctgaggctaatggcacaaaaa
tccttgtagatgccattctggagccatcattccaagacttggctgattcgttgctgatgacgttgctactgatcctcaatgagccgtcgacgcgaaaatt
cattgagcctttcgtggattctcaggtgcttttggcgccgtttacagacacggatttacctgcaggtaatgaaaggagacagcggtggatggcgagtcgg
aatgcaattgtgactatgatgcggtcgtggacgggaatggtggtgctgacgagcaacccgcagggtctgcagtcactcattcagctactggtgcggccag
ttggagaggacgtccagaaagcggtgttgtctactatttgcgagattttttacaagaagacgagctttgacaggtcagcagctgacgctgctgcggacac
ccctgttctccctgttagtttgtccagtgcagagcaattgccactcgcagttaaccacaatttgctggacaattacacagtgataatcctgctagctatg
atccattgcgggattctcgaggcactggtgactttagggacggggccgtctcgagcgttggcggatccagcaattgacctcttagcggatattttacgta
tggcttcacgtctgctgccggaccagcactgtgcttcattactagcactcccccgactagtgtcatcaacttcgcttactacgactaccacaatgtccct
tggtgaccacgcaaagagcctgctggagcgtctgcaacgagaaaaatcaattcgagctagcgaaatgctaggtgaactggctaatgctgttggtgcaaac
tcagggagcatcgccacacgtggcgtgtcgttggtttcgtacggcggaagtggtgttaacggcgtgcagctagcgtcggagcttctgcgtgatacaaatc
gaccgtccaatctcctcgctctgcagcagattgcgggcgtggtacgtctgccgtcttcaagtggcggtggtggcattggaactggaggtggatcggcaaa
ttacgctgttgcggctccttcaacacagcgtggcacgaagagtgcgactgctcaactcaaagacagtctaacatcacgagaactaatggttcttgaattg
aagcaatctctagatgctcagatggacgacagcacgtttaaggacatgctgcacaaccgttcgcgtgtgttgacggacaaaaactacaaaaactggaatt
gggacatcatttctgaaatgcttgagggtccgttgacaaacccgcagcgactgtcggaggccatgaaaaccaagttctttaagcgtctttcaggcttttt
ccggtgcgatcagggcaacaagggttatttctccaacctgtactggatcccagaccacgtaccgtacttgcgtccagcctgtcaaatgtatacgctactg
ttgaaccaccccgaaggcctgcttttcctaaagactgatcgccgtgggcaattattgacagagatttcatcggcactggagctggaggcacgacccgagg
ctgctatcgttgagtcacatattggagtccttaaggcgcgcatgttttcaccggattacgtgtctagacgtatgttacgcgaatacttcacacttttagg
actcatgagctcgagcaaggaaggtctcaagatgatggaacagtcaaatctgttccagcggctttacgtgatggggactacgaaaggccacgatttcctg
tgccgccttattcttgcgaacttggactactcagtcgacggcagttcccggaaactactgcagtcttggatgatggagggttcaaaggctctacgcttgt
atgcgacttgtttgttgcgtgctttgctgcgttccgaggtcgcagactttgataaatggggtatcgatgctctcgtgactcagctcacacaggaggaaga
ggtcgccaaggcagcactgagtgtgctagaggaagcagccgaaacccccgcatgtttgttagcgatgattctgaagcgaccaatgaagttgattcagcta
aaggataagcgagctgagtccctacttcttcggtcgctttcgctagctgagggactgaacttcctacgtgacactggtgactggatccctcgcactcttg
ctgcttggcgtcgtgagaaacatatctcctatgttcacgcagttgagcatgcgcttttccgtggcttgcatcgcgatgctgctggacgtgaacgtgggtc
gagcaacagcgcaaccagcacacggcaaacgtgttctcctacgcccatcccagttaatgtgcctatgaagcgaggtggtggggtcgggctcaaacctcct
agtggtggaagcagccagcgttctctgtgggggctggactggctgtaccgtatgccgtggaacatggaggtgaagattgtaggtcctcctggaagcggcc
ctccttcgaatctcatcttggaaacgtacatcgatggcgcaatgcgagacgaggatgaagctactgggattgacgacgaacttcgcatgaactcgattcg
cggaagggaatcgttgtagatgctcgcaatatgcctcaacccgtggtcgtgaactcacaacagacactgcaggcttgtctgttcctaggtacgcaacctg
tggaccggcgtggatttacgaagcctcctcctcaaagcaacggaggcttcgtgtctaccagcgggtctgctagcagcggcggcagtgcgctctcgagtga
tacacaacagaagatgctacgagctcgatcggcgtctaactcagctggtggaagcatggatcgtagttcggagacgatgatgtcgttggactttgcagat
actggatcatcttcggttgacgcagtgaaggaggagaacaaggactggagttcatgccagccagagcagcgatccccgcagtatctaacagcaccggaat
gctctttgtgtgcccctggtgagcgtgctgtctggaacttccgagtggaaatggactcggcagctggcaccaacacttcaaacgggagcgtcaagcgtct
cctgctaaagtctgttgagtttacgctgcaattgcttccccttcgtccacgtactgtgccactgcctgtgcatttgtatggcgaactggcaaaaactagt
gctggctgccagatccttcactcctctgggcatttgccggaattcttagcctgtcttcgcgatgccgcaagtgttccacttgaaaaacgtgccgcattgt
gggcacttggtcacgtgtccgccacaccacgaggctacgatctgttgaatcactacgctcaagactttgtggacatgatcgttaagttggccaccgattc
cccacttgtttccattcgaggaacttgcttctttgtgctgggtttgcttgcgcgatcccctgctggtcgacgacacttggcgcggcttggctgggacgct
ccacgtgacgcgtctcgtacgtccatcgctgtcccgcagaactgcacgtcgctcttcatgtggccaccgtccggatcctcaactccctgtccgttaacac
agacaccaggtgcttcaccgttgcagcgcctactaatccgccgacgtgacaagatgcccaacgagtggcgcgaagtcctacgctttgtagcagacctgag
taaccacatcacccagaaggaggcccatgcttcgctcaacaagctacgctcatcaaagccggagctgttcgaggagccggtgctgctaatgtatgtgcat
gcgttactggagaagtacagctaccgtttggcactacgtcagttcgttctcaacgcgttcgaccgtgccacgttgacggacgaagtgctggacacactgc
ggattgaagacgaggaagaacagggcagccaaacacgccagcgtgcaccgactggtcgagagctacgacgacgtcgctcgtctccttctatcccgtcgtt
cacggcctcggtccagtcgctgaacgcagctatgcaggccacgtccagtgtctctcgcatgtcctcgatgcagaacgtactcagctctggtggcaatatg
ggcgaccaccgccccactatgaggatgaatgtgcacaacgatcccatcgatcgcactgtattgctcaagcgtaaccgcaagcgctccgctttctccgaga
agaccatcgttgtcggtgcacctgaagctgttgtgtaggcagatagacgagctcgtgtgtcaatgcgtaacgtttctcagtccttttctccactacctgt
ctatctattacaaaaacctccctgaggccaagtccatgagtgaatctcccatgtgcaacacctccaatttgcacagtttcccattgagagtcgtgcacat
ggtgatggctccacgcagagtctccagtccgccgcgttggacgcgcaacagagccgtactgggctcgtagctattggaaggctgtttgtcgaaggtcagg
acgtcgaattcgctggctgaagctcccaccacaccgaacgccgtcttgagagtcgtgtcaatgccgaatttgagctgctttacgtccgcaactggctcag
aaccgtcttcggagaagctaaagatggacaacgaataagttactggcagtatacaatggacggcaaagaagtcagagcgtacatagcaatcttgaggtag
ctgtgctcgccatgcagcgagaatttgtggtgcggtgtcggggctgaggttgccatt