Description :
From Genome Similarity Track
Location :
contig_76:149740- 152180
Transcript NameFunction/comments
g11881.t1hypothetical protein

Sequence
2440 bases(100 bases per row)
AAGTTGAAGTGGAAGACAGATCCCGCTTGAGCTCCGCGTGACCGCAGATTAACGCGACTGACAACACGTTGATGAGTGGTTCCTCTTGAAACGAGACCTC
GTTCACCAGTCGAAATAGTTGAGCTGGCCTCGGTGTTAAGGTGGTACATGTAGCAGTTGCAGTTGCAGTCGTCGAGTTGACTTAAGTGAGAATTAGTGCT
GATACAACTTGCTGCATATTGTGCAAGTCGAGACAACACAAGCCGCGCCTCCAATGTCCTGGACCCTTGTCAGGAGTCGTAGAGTCTTCTGGAAATCTAA
ACAATCGCCTATCACTGTTGTGAAGAGACGCTCCATATCCAAAAAGTGAGCTGCTAATCACCATGGCGTTCCGCTGCGCTGGGAGTCCGCTAGACGAAAT
GAAGAGGCTGGAGAAGTTGCGTGAGCAAGACCCGGAGTCTGCAGCCAACTTGGTGGCCAACGGGAAGCTCCTCGTCGCTTTTACCCACGACGGGAATCTG
CGTGCACTTCAATGTGCAGCTGAGCAGCTAGAGGAGGTACGACGACCTGCAACCACTTTCTTCCTTTTGTTTGACGCGGATCATGTCTTGACTGATACTC
ACTCATGACAGGGGCAAGTGCTCATGTTTTATGTCGTGCGGATGTTCCGCGAGGCCTGCTCGACGAGGAGACTGGACATCCTGCGATTCCTGCTGCTCAA
TGGATTCGACCTCCAGCAAAGTTACACGCGAGATGCCTGCACGGGGTCATTGAGAGTATTGACAGTCCGCAAAGAGCTGATGCTGTACAACCCCTCATTC
GGTTTCTCCTGGACGCTGGCGTCGACGTCAATTGGCAGAGGAAGTCCGACCTGTACACGGCACTACACGTCGCGTGCTGCAAGAACTTGTACCCCATCGT
GTACTTGCTCGTTCTGTACGGCGCCGACGTGAATGCCATCGCTGCGGTGGGTATTAAAGTGATACAAATTGAGTGCAAATATCGCTAGAAATGCTAACGC
TGCTTTTGACTGCGATGCTGCAGGATGATGCCATGCCGCTCGCGTGTGCAAACAAAATTGGCGACACGAGCACTTTATCAGAAGCTGAACAATCGCAGAA
GGAAATGCTCGTGTCCTTTTTGGTGGAAAACCAAGCACGAGAGACCTGGAGAAGGCAACCACGTCGAGTTACTCCAGCAGCGTCGATGAGTGCGAGCTCG
CCCAGCCCAGAAGCTGGTGAATCTGCAGTAAGTCCAGTCAAACGACCGATCTTGAGCTTTTCGAGTAGTTTCGGTATCCACTGTAGCATTGACGAACCGA
CAGACAACCAGCCCCAGGAAGGTCTCCGATTTGACACATCGGACACCTCCGAAAGCCTGTAGGCGTTTGCAATTAGGTGGTTTCACCAGCACCCGAGAAA
TGAGATGCAACAGAAACAAAAATACAAACTTGACTTGTTCAAGCTGTCCTTTAACCTGTGTCGGTCTCTTGCTTTTCATAGCTCAGCATTCTTTGCATCT
GCGCGGCTTCATCCTAGAACTTCTTACGAACCGCGGCATCACACATGTCGTGCAGCCTCATTGAGGCCAAGTTCCAGGTGCTGGACCGCACCATCAGGAT
GTTGTCCAAGTCCAAAAGCTTGCGCACGCCGAAAGTCGCGTCGTCCGAGCAGCTTCGCGATCTTGTAGAAACCCAGAAGCCGACCTCTCTTCTGCCGACG
CTAAACGCTGTGAAGGGCGTAGTGGTGACACGAAACAACCAGACGTACCCGACCGGTGAGAAGACAAGTCGATCGCAGCCGAGTACTGCGCGCGAAGAGA
AATCTGAAAAGAGATCAGGACACTCACCACCACGCCCAAGCACTGGGAGGAGAGATCCATACGAAAGCTCGACCGAACTGCTCCCAGACAAGTGGGTCGA
CCCAAAGCAACGGCGAGCAGAGCAGCTTCTGCAGGAGACTTGGCATGTACGTCTCGGATTAGCTATCAGAGCGATACTATCACCTAACTGTATGGTTTGC
ACGGCAGGAAATCGAGTCTGCTGTAAACTGGGGTCAAGAATTGGGCTCTCCCACCCGAGAGGTAGGCTTACGGTTGGCAGTTCAAACTCGTGTGATCCTG
ACTAATTGAACGGCGATGTCATGCTCTAGGCGCTTCGGTCGAAGTTGCTCAACGAAAGTGTACAAGATGATCGCCAAGAGCAAGAGTCGATATCAAGCCA
GCGTCAAATACTAGAGCAATATGGATAACCAAATTAACGGCGATTCAGGTGAGCAATTAGACTATCGATTCACCAAACAGTTTGCTGACGCTGTTGCTGC
TTCGACCCTTCTGTCTATTGGGCTGTAGATGCGCTTAGTGCTGCAGTGCACAACGCTTTGCCCCCACCAAAACGACCGCTGACATCAACGGGCTTGCAAC
CGAAGAAGAGCAAAGCTTATTTGAGCGCGCGATGCCGATC