Description :
From Genome Similarity Track
Location :
Scaffold_98:149731- 151575
Sequence
1844 bases(100 bases per row)
CGTGTCGCCTTCCATACTTAAATCTCCTTCACGATATCTGGACGAGTTGCGGGAAAGACCGTATCGTCGGAGCGTCGGTGGCCTTCATTGATACTTCGTG
GCGGTTTAGATTCATTGCAATGCTCGCAACCGTCAAAAACGAGGGACACAACGCACCTCTAGTTGCAAAGGTGATTGAGAGTGGATTCACGGCGAAGTAC
GACATCGGCATCAATGCTATGACTCGCTTCACTATGTCCGACACGACACCTTCGGCTCGGAACGTCGCCGATCATATCGACAGCGAGCAAGAGGACTGCT
CAATGCATCTACTCAACTTGTGCATTGGGTATGGACTTGGGCTCAAAGACAATATTCAAACGAATAGTGTTTGGAACGCCGCGTGCCATTCCTGGGATAA
GGTGGTGACCATAGTAACTCCTGGTGGCTCTCTAGAGGATGGAGGTGACGTCATTCAGAAGTTAAGGAACTTGAATAACCATTTCAGGTCCCCGAAACAA
CGCAACGCGCTGAAAAAAATACAAGAAGCTCTCTCCTATCCTGAGCTGGACCCCATGGCCGACAAGGACGTTAGAGTCGCTTACACTTGCAAGCTCATTA
GGCGGTCGATGGTGAACTATGCAGCGTTCGAAGCATACTTCCAGTCAACCAAAGACTCCAGTAGCGTGTGGTCAAATTTATCTCCAGACGACTGGACTCT
TGCTACCGAGATGGTGGCCGTTACACACTTCATCGCCAACCTGGCGCTAATAGAAACGCAGAGCGAAAACCTGGTGTCGTCCTACATGGTAGTATTCCGA
CGCCTTGCCGAAAAGAAGCTGAAGTCGTTCAAGTTCGACGCGATGGTCGTCGAGGCCCCTCGGGCAAAGGATGCAAATGAAGCGAGTCATTGCCGCGCGG
TGAAGACACTAGACCAGTTCTCGGAAGCAGGGAAGACAAGTCTGAGGAGGACATTACTACAATTACAAGCACGATTTCCCAAGGTGACGAAGGAAGCAAT
GGCGTGTATACTACTCGACCCCCGGACTAAGTCAAGTGCAAAAAAAATCGCCGCTGTCGGCAACATCCCGCGCAAAGAGGAGAAGTCTATCTACAAAAAC
GGTCTTGGTTACCTCCGAGCCGAGCACCGCAAAGTGTTCGCGCAGATGGCGAAGTTGGGCAAGATGTCGCTGTCGCCGCCCTCTTCGCAGAGCAGCCTAC
TCAGTCAGGACGTGAATTCCCCCTTTTCCTCTCCGTCATCGACAGGATGGGACGACGAAGATGAGCTGCTGCTCGGTGCTCCAATTCGAACGAGTAAGAC
CAGAGAAGAGGTGAAGGAGTAAGAAATCAATGCGAGAGCGGATAGTATCATGAGAGAATGGCTGGAGATGGAGCCTGAGTGGCTCAAGGTTGCCCAACGC
CAAAATCCAGACATCCAGAAAGAAGATTTGTCCTCCGCAATGACTACCGACAGCCGCAACGGCATGTGCTGGTCCTTACTGGGGCTGTACAAACATGTTG
ATGTGCTACAGTGGTTCCGTGATGAAGGCGAGAGCCTATACCCTTCGATGGCGCTTCTGGCACGAATTCACCTCGGCAAGATCTCATCCTCGGCCTTCCA
AGAGCGAGTGTTTTCCACAGGGGGGATAATCATGGGGGCGCTTCGTACCAGAACAGATAGCAGACGATCGGAGAAGCAGCTACTGCTGAGGCACAACAGG
GACGAGATTGTGAAGTTGAAGCGAGACGCGCGCAAGTGACGTTTCAAAAGTGACGTAATAGTACTTCGAGTATTACTACTAATAGTACTACTATTAAAAC
CTTGTTGTGTTTTCGGTACTATTATTAGTATTACCCAACAATAA