Description :
From Genome Similarity Track
Location :
Scaffold_256:14972- 16421
Transcript NameFunction/comments
Phymu_g7608ATP-binding Cassette (ABC) Superfamily

Sequence
1449 bases(100 bases per row)
CGGATAGCCAAGTCCGTAGCCGCGTACCCGTTAAGTAAGATCTTGCCCTTGATCGTCCCCTCTGTCTTCCTGCCAGCTATCACgtccatcagcgtcgtct
ttCCAGCTCCAGATGACCCCATCAACGCAGTGATAGAACCTGGTAAGGCAAAGCCACTGATTCCTTTCAGCAAGTCGAGAGATTCCTTCGGGTTGGTTGG
AGAGCGGACAGAGTACCACAAGTCTTGGAAAGCGACTGTCACCGGGATGAAATttttctcctgctccttgaCTTCGAGAATTGCTTCCTTGTGAAGAGAC
TGGGACGATCTCGTCTTCGGAGTTGCTAAAAGATCGTAGTTCTCGTCACTTAGAGCCTCTTTCTTCGATGTCGCCACGTGCTCGGGGCTTTCGTATCTCT
TGTACTCCAGTACGAGGAATCCGAGACCCATGAAGGCAGTGTACGCAGCAACCATGAAGATAGCACCTAACACAATCCAGTACTTCTCGGACGAGACGTC
GAACAACGACATGTTGTACTCGCCCATTCTCACGCCAAACTGCGCGCAATAGTCGATGCCTTCGTACACACAGACGTCGAATGGATCCGAGCGATACTGG
TTCACTGCCATCGCCCGCAAACACCACGAGATGGGGTCCAACCAGTAAATCCAAATGAAATAGTCCGGGATCTGGTTCTTCGGGATGATGAAACCAGCGA
AAACGATGAAAaagacgatggagatcatCGCGATCGGCTTGGAGACGTGGCTGTCGCGTGCTAtagcagtgatgaagaagaaccaagCAGCGAACGCCAT
GTTCGTCAGGATCAGGAGGaccatgaagatgatgaagtgCTCAGCAGAGTTCACAAAGCCGCAGAGCCAGTAGATCAAAGTGCCAAACACCAGACTTTCG
CCTACAGCCAGCGGTAATTGAGCCACCGAACACGAGACCACGTAGGCTGACGATCGATAGAAATTGGCTCCTCGTTGCTTGTAGAAAATGTCACGAGCAG
CCATGAACGTCGGGATCTGAGAGGCCTGGCccaaagccaagaagaggatGGACTGGAACAGAACACCTATCATCACCTGGGCATTCGTCGGATCGACGTC
CCAGAACGTGGACGCGTTGATGAGACCCATGACGATGGTAATGACCGCTCGACCACGAAGGAAAGCCGTGTTCCTCATGGTAAGCATAGCTTGTCTACGC
ATCAGAGTGGTCGTGTTGCCCCAGAAAGACTGCTGGAACTCCGACATCGGGTCAATATCCTCCGTTTTGCTGTTCAGAAGCTCATGATCGTGAGGTTCTT
CCAGTCTACCCAGCATATCCTGGTAGATCCTCGACTGTCGAAAAAGGAGCCCAAACTCGCTGGGTTCCCGTGGACAGTGCCTGGTGCTCACTTGGTATTG
GaattgctgcttggtgccCAGATCCAACAGGAAATCAGCCACGTCCCGT