Description :
From Genome Similarity Track
Location :
Scaffold_18:149718- 151856
Transcript NameFunction/comments
Aphas_H257_08199Chloride Channel (ClC) Family putative

Sequence
2138 bases(100 bases per row)
TGTACTGGCTGCGACAAAAAATATCAGAAAACACCTATTTTTGCAACACCTATTTTTGCAACTTTTCAGAAATATTATGACAGTTTTTCAAACGACGGCT
TTTGTGTGTTTGGCTACCAAATCTGACATATATAAAGTGACACAATACGTCGCGTTTTTACTGTTTTCTGACAGAAAAACGTTTGAACTGCAACATGTTA
TTCTTTAGTTCTCCTTCCATCATAGCATCCAGAGGTCATATCAAAATATTTTGAAAATATTTTCTCACCTCCCATTTGAAACGGGAATTCTCTGTGGCAT
CCAAACTCGGCCTAAATCTTTAAAAAATATAATGATTTAACAGTAAATGTTATTTTTAAAGTGTACATTATACTATATGTACATGTCTAGAGGCGGATTC
GAACCACCGACACATAGATTTTCAGTCTTTTACAGTCTTTTACATATGCTTGAAGTTAGTCCTAATTTATGATCAACTTACTACGTAGTATCTAAGTACA
TGACTTTCACATCACATACACTGTAGCTCACTGACGGCTTGTCTACAAGCGGTGCAGCGAATAACATATTGCAAACTTAGTTGCAGTCTATCGTTCAAGG
CTAGAAATGTAACGATTGCAACGTTGTAGCGTGAGTGACGAGTCGTCAAAGGAGCCAAAAAACTCAAATATAACCTACTTTTCAAGTAAATAATGGTAAC
TCGATGAATATAGCTCGTAACGAACGACCTCTATGATACGTCATTACATTGTAAAGATAATGCTTATGAACACGCGACCTGAGTCTCTGAATTCAGGAAT
CGGATTACTTGGCCCATGTGGCCTATGTTGTTTGACTTTGAAATGGCTGTGTCAAATATTTGCTGCAAATATTACGTACTACTATTAATAAAAGATCACA
TAACGTTAACAACGTATTGATTTGTTATTTACTGTTAAAAAGAATAGTTCACACCATGGTAAAAATAATGAAATGGTTTTATTGTTTCGAAGAAAAGTGC
GCATTTCCATGGAGGAAGGTTGAGGACCAAATCACCAGTGAAGATGCGACGACGAAGGGTTCTGTCAACCAGGTGAAGCAAGAACTAATCCGATCGTGTA
ACATTGAGATTATAGATAGGCATCAGCTCCATCGAGTTCGTTCTAATATGACCCTCCTTCTTTTAATATTTTAGCCATGTACTATTAATAATATTGTACC
GTTAATGCTAACACATTACAGGTGTTTTCTAAATTATATAACGTGTTATACGTATTTGTATTCCATAATAGAGCGTTATATTCCCGAATTATAACATTTT
GTCGAAGAAGTGCACTCACTGCCTCGAAGTTTGTTTAAATTGTTCAAGTTTAATTTGCACTACAAATATCAAGTACAGAGTGTATTTTATGACTCGGTGG
GGATTCGCTCACGCTTTCAGGACATATATATATTCGACAACAGAAGAAGCGGACCTCACATGGCGGTTCACAGCAGCAAATACGACCTCTTGGTGAAGCT
CCTCCTCATCGGAGACAGCGGTGCGTTGGTGATGCCGATGACTCCCTTTATGTGGCTGTATGGATATGCATAACACTAACCTTGACTTCATGCAGGCGTG
GGGAAATCGTGCCTGCTCATGAGGTACTCTGACGACTCGTTCACAACGTCCTTCATCACGACGATTGGGATCGATTTCAAAGTCAAGACGATCGATGTCG
ACGGAAAACGCGTGAAGCTGCAGATCTGGGACACTGCTGGCCAAGAGCGCTTCCGAACCATCACCACAGGTGCTTCCATGTCGTTCGCATTGAAGTCATG
GATCTCATACTTTTCTGCATAAACACAGCGTATTACCGTGGCGCCATGGGAATTCTCTTGGTCTACGACGTCACCGACGACCATTCCTTCCAAAGTACGT
TCCATGTCTCCGTTGGGTCGCTTCCTTACCGCGATGCTCCATTAGATGTACGGAACTGGATGCGGCAGATCCAACAGCATGCGTCTCCGAACGTGAACAA
GATACTTGTGGCCAACAAGTGCGACGTCGATCCGTCCGAGCGAGTATGCCATATCGTTCATTCCTTCCATCATGACGGCCTCATGTCCATTTTCAATAGG
TTGTGTCCAAGGAACAAGGCGAGGCGTTGGCAGCGGAA