Description :
From Genome Similarity Track
Location :
Scaffold_8:149702- 154992
Sequence
5290 bases(100 bases per row)
TACGATCATGTTCAAGTCGATACGACTGCAACAATTAGGCGCCATACTGATCCCATTCCGTCCGAATTGTGTGTCGCTATGTATTCGGACCTAAGTTTGA
GAGACCGAATTCTGAGTGATCGAGAGCTAGCGTCTGGTTACCCAACAGATTGCGGACACATTATCGCACATACACCATCATTGTTCTTCTTGTGTACGCG
TATGGGCCCCCCCTCTTCAAAATCTCTGGAGCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCACTTTTAGCCGACACACTACTATTCTACGCTCGCACGCTATCAAAAAATC
GTTGAGGTACTCGCCGAAAAGACCTACCCGGGGACATCACTGAGCAAGAGGAACTACCGATTGAACAGGTACTGCTTGCTGTGTCTTGCATTAAGAATGA
GCTGATTGTGATGGATGAAAAAACGGCTGGTGTCTGGGCTGGTACATCAATCTCGCGAAATCTTCTTGTTAAAGTCATCAAATGGAGAGGTTGTTTCCCT
CAACCTACTTACATCGCTCCAAATTAGTTAGTGAACTACAACTCATTCTTATGTACACATTGTGGGAAACTGATGCTGTGCTTGCTGGACTATCAGTGGC
AAAATTAACAATGGCGGAAGCGAAAACATCGTGAGTCAGTGAGCCATATGGGGTTTTGGTCAACTATCGAGACACGTTAAAAGACGATGGCAGCATCGAT
GCGTACGCCAAGGCGGTTTTGAACACCCAAACATTCACAGATTTGAAGGCAGACGCGGTCCGCCTAGGCCGTGTTGACCCGCACTGGGTTAGTGCAGTTC
TAGCGTGTGAACCTGTCTAGGCTTCATACTAGAGAGCGATCTACATAAAGGGGTAAGTATCGCGATAGTCAAAAATCTGGAAGATGCACTCACCTTGGAC
ATAAACTATCCCGGGAAGGGTGCGCTTCTCACGAAACTCATCTGATACACCGGTCCATTCTGCAATGACTCGAAAATTTGCGAGGTTCTGTCACGCTTTT
TATACAATTTCCGGAACTGGTTGGGCCAGCACAATAGGGTCCATTTACACCATAAGCGGAGAGGAACCCGAACATGTCAATTGGGTCTTGAGCGCAGGCG
GAAGGTACTTTTGAAATCTTACACGACGCAAGGGCTTTCGTCTACACCCATAAATACCATGGCGGAATGTGATCAATTTGCATCACTTGCGCATGATGCA
CCTGTCCCCTTTGCCGCGCACCCGACTAGGACACAAATCTAATATGGACGGGTGCTTGTCGCTGGAAACACCATTCTGATTCGGTGAAGAAACTAACTGC
AAGGATGCTTTCCAGGTACTGTGAAGCACGACCAGCGAACAAACAGCCGTGAGCACGAATGAGTTACCCACCGTTTTAAAAGTATGTTCTGGCGCAATCT
ACGACATACCCCTGCTAAGTCCCCATATGTTTCACAGATGCTATACCGACTAAAGTTTAACCGTTTCCCACCTCAGAAAAGTTAGAGAGGAACCTGTTGT
GGCCAGCACCCGAATGATCTTCCAGACACTATGCTCCTTCAAGCCATGTTTTATGGGATTGCTACATCTCCAAGAGACGATGCCGGTACATTTGGGAGTT
CTGGGCCAGGCTCCGTAGCTTAATTGACGACGAGTTGCCGATAAATATATTTTCACTCGACATTCTACAATACTAAAAATTTGCTTGGGACATAGTTTAA
GCTTCTTTAAATGCGTGCGATGGGGCATTGGACGCTCTCGAAGGTGTTTTTACAGCTAGGAACAAACTATGGCGCCTCATAGTGTTGATCACATTTCACG
AAATATGATTGGAGCAGCTACTTCGGATCTACGATACAAAGCTGTCACCGGGCACCTATCATGAGATTTTACAGTCCGTTTAGCAGAGCACTCTCGAGCT
TTCTAAGTATTAATTACCTACTGGGTGGTGATAGCCGGGAATACGTGGTAGCAAGGGTGCGCTCAGCATTATAGGATGACCTACTACCGAACACAGAGTC
TGCCCTTCTAAATACTACATGATATCCTGAATTCTTTTAAGTACATATTTTACAATAATTCGATTATGGCCCTGTAGGTTATCTCGGGCAAGGCGGATTA
GGGTTCGTCATCGTCTGTTTTTGGCCACAGTTTACGCCGTTACACTTACACTCATGGTTAATAATACCCGAACACCCTTAAAACTTACAATATCTAGGCT
TATAATGGTCATTTTTAGACGCTGTTTTGATATGTTTAGCCTCTCGACGAGTGCCATGCGTGGTTGTGCTACAGCGCTAGTTTTGCTACTCTGGAGAGAG
GCTACCATACAATTTCCTAACGTGCAGGGTGGACAAAATCACTGAACAAAGAATGCATATAAAAATATATATAATGATAGAGTGATGTAATGCAGGTGAG
TGAAGATTAATAGTTAGTCTCAATCTTGTCACCTTTTTTCATAATAGTCTCTACACAGCCCTGAAGCATGGAGCCGATCTGAGCTCGAACCTCGCCCAGT
GTTATCGATCCCATGCATCGAAGATGGTCTATTGGAGTTCCATGCGTGTATCGTACTGTTTGCCATAACATACACGCGACGACCCTTTATGGAACACATA
CTAGCGATGGTGCTGAGGTCAGGGGGTCGGGCTGACCAATCCATAACCGTCGACCCACTCTGAGAGAAGAACTCCTTCGTCTTACGAGAAGCGTGGATCG
GTGCATATTTCTTGCTGAAAGAAGAACTCCATGCCATACTTTAGGTGGGTGAAGGGGAGTAGATACTCCCCAATGGTGTAGACATAGTGGGGAGAGGTTT
GGCCGCACTATCGCTCTTCCACTCTCAACTAATAGCCCCCCTCACATCTACCGCCTCTTGTTGGCGCCGGACGGCCTACTGCGCTGGAAGACGAAGATCG
CGCCAGTAGAAGCGTAAGCCGTCCGGGCCGTCAAAGTTGAACTTCGTCTCGTCTGAGAAGATGAAAGCCTTCCAGTTCTGTTGGGTTATCATCTTCTCTG
ACGCTCAATGTAGTCGCGCAACCTTGGGCTCCGCACGAAGCGGAAGCGACTCCTCCATACTTTAGTACTGCAGAAAGTCGCGGCGAGACAAAACACGGCG
CACCGAGCGTGCGCTGCACGTCAGCTCGATGTCGGCCTTCATCTTGGCGGACTTGGCTTGTTCCTTGGCGGAGGCGCGGACGAGACGTCTTGTGTCGCTC
TCGGAGAGCTTTGGAGGGCTATCGACTTGCTTCATAGCCTTCTTGGTCTTCTTCGTGAGGACGCTTGAGATGGTGGAGATTAGTTGTTCCACGTAATCCC
TAATATAGCGGTACGTGAGACCTACATCACGTAGCCCTTGATGCGGCCGACCACTTGAGGTGTGAATAAGTTGTAGGGCGCCATTTAGTGACTGGAAACC
ACGCGGTGAGATGACCACCAGTTCCGTGTGACCAACACTCTATTGATTTATACCTTTGTATGAATTCTTTATTCAGTGATTTCGTCCGCCCTGCATGTTA
GTTAATGCCCCCCTCCAGAGTAGCAAAACTCGCACCGTAGCCACAACCACGCATGGCGCTGGTTGATAGGCTAAACACATCAAAACAGCG