Description :
From Genome Similarity Track
Location :
Scaffold_126:1497- 4522
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014973Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
3025 bases(100 bases per row)
AAGTTCCTCCCAAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGTAGTCCTTTC
AACGACCACGTCAAGAGTCTGCATAGGCCGCTGTGTAGCGTGCGCAGACATTCCAAGACCCTGTCCGATTGTGAGAAACAATGGAAGGGATGAGACGCCG
ATGGGCTCGATGCCTGAGAAACCGTGGAGCTGACGAATGAGCATTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGGTCATC
GGTGAGGCGGCTGTGATCAGCTTGCTGAAATCAGCGTCACCGGTTGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGATCATGAACTCTCATC
GACAGTCTGCAACTCCTGTCACGACGATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGTACCGTGGCGGAGAGAACGAGCCTCTAGCGAGATGGTT
CGTTGAGTTGGATGCAGCGATCACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAAGTTGG
GCGTATGGGAAGCGATTGGCGGAGCCACATTGCTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGAATTTC
GGGCTCGCGCAGAGTTTTTAAAGCTTCGTCAGGGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCATCGTGGACGAGCC
GATTGACATCCCAACGCAAGTCGTGACGTTCATGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAAGACCCTGGAAGGA
GCCATCAGCCGTGCGATGCAAGAAGAATTCAGCATCAAGCAAGCCAAATTCCAAGGTTTTCCGGCAAGACCACCAAGGCAACCAAACGTTGTTCATGATG
GCCCAGAGCCGATGGACATCTCGTACATTTCCACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGCCGGGTCACTTCGC
TCGGAACTGCAAAGTGTCTTTGTCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTTCGATCGTTCCCAA
AGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGAAACACAGGACTCTGGCCCCAATGT
GCATGATGCACATGCAGTTTCCACGAGTGAGAAGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTCTA
CGAGCTTTGGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAATGAAGAGAAGACGA
TGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCGAGGACGAGTTCAT
CCTTCTCGACCTCGATGACAAGTTTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACATGAAGATCTCCGTT
GACAAGTCATGCAGCGCTGACTTGAGCAGCATGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGCCCTTGTGATATTG
CGGTGTGCGATGGCCCCCCATGTTCACAAGTGGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGACTGTCTCCTTTGC
CATCGACGACAAAGTTGCGTGCGATGGTAGTATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGACCAGCAAGAAGAGT
GTTTCATCAAGAGTTTCAAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAATTTGTGAATATCG
CGGTCTGCAAGGAAGAAGGTGACGTGAATGTAATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCTTGCCATCGATGAG
CAAGAAGACGCTGAAGCGTAGCCTAGCGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGGCGATGCAGAGGACATCAGCACAGTATCAGCA
ATGGAAGCTGAAGTGCTTGATGAGAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTATGCACTTGCCAGGG
AATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGAAGTACTGCAT
CACAAGACAGTGGCCGTTGCCAAAGGAACAAGTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGAGAGTAAGTCTCCG
CATTGCAGCCCCACTTTCTGTGTGAAGAAAGCAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATACCTGCTCAAACTC
CGGTTCCACGCAAGGACATGATCCTTGATGGAATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCGA
AGATGATGTCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCTCCTGCGACCTTCAAT
CGAATGGTCACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAATGGGAGATCTGATG
TTGATGTTCATCTTGATCATCTTCG