Description :
From Genome Similarity Track
Location :
Scaffold_53:149690- 150735
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16058hypothetical protein
Phypa_INRA-310PPTG_16059hypothetical protein

Sequence
1045 bases(100 bases per row)
AGTCGACAGTCTCCAACTCATTGATTATCTGCTGGCATTGACGTCGACGATCTTCCGCGGTATCAGCACTTCCAGCAGCAGATACCGTGACTTGAAATGC
TGGGTCACCTGCTCCCCCCGTCTTCACGGACAGGTAAAGCACAGGGTTGTTGGGGAGCGGAAATTCTGGGTGGAAGCGATACCTGCCCTCATCGTCCCTC
AAAATGCCGTCGATCGGACTGATTTCCAGGAGATCTCTCACTTTTGTCAGCAAAAATCTGTCCGATGCCACTGTCACTTCAGTCGGGCCAGGAGAAGCTC
CCTCCTCCGCACTTCGTAGGGCTTGAAACCTACCTAGCTGGAAATAAACCACTCGGAACGGTGAGCGCTTAGTGAGAGGCTGTTGTGTACCTGGACTGAT
ACATTCCAACTCGATGAACCCTGCTATCGGACGAGGGACGTCATGAATCGATGCTTGCAGTTGGATCCGCCCCATAGCCCCGAGAGAATCAAGCGTTGCA
GAGAAGAATGGCTCCTCTGAACTGTAGAGTTGAGCACGGATCTTCGTCTGACCCAACGCGATCTCCGAGTGGTTTTTCACGTCGATGATCAGACCTCCGT
GGACTTGGTAACTGGAAGATATCCACAGATTCTGAAGCATGGCCGACTCCATCACCTCGTTCATCATGCGCATCACATCTGCACTCTGTGATAAACTCTG
CCCCACGCGCTCAAAGACCGACTCAAACGACTGCTGCAGGCCGCCAGCGTACGCCCCTAGCGCCTTTGCCATGTCATCCATCGCAATTCAAAATTAAGCG
CAAATTTACAATTATAGACATGGCTACACATGGTCAAGTGGTCGTTGCTGATTTCATGGAGTACCACCGCAAAGCAAAATAGTAATGCTTGAGAAGCTCT
TTCGAGCAATCAGCTGCTCCTGGGCCACCCGCAGGCACTCAGAAGCACTTGTTTTTTTTTTGTGATCACGCTCTTGCCTGACGAGTGTAGGCCAAGGGAC
GGTCTTGTCCACGTAGCTTGCATTCAAGCAGTCGGCGCATGTTCC