Description :
From Genome Similarity Track
Location :
contig_76:149686- 152126
Transcript NameFunction/comments
g12445.t1hypothetical protein

Sequence
2440 bases(100 bases per row)
AACCTCGTTCCTGGATGGTAGAAGCACAAGTTGAAGTGGAAGACAGATCCCGCTTGAGCTCCGCGTGACCGCAGATTAACGCGACTGACAACACGTTGAT
GAGTGGTTCCTCTTGAAACGAGACCTCGTTCACCAGTCGAAATAGTTGAGCTGGCCTCGGTGTTAAGGTGGTACATGTAGCAGTTGCAGTTGCAGTCGTC
GAGTTGACTTAAGTGAGAATTAGTGCTGATACAACTTGCTGCATATTGTGCAAGTCGAGACAACACAAGCCGCGCCTCCAATGTCCTGGACCCTTGTCAG
GAGTCGTAGAGTCTTCTGGAAATCTAAACAATCGCCTATCACTGTTGTGAAGAGACGCTCCATATCCAAAAAGTGAGCTGCTAATCACCATGGCGTTCCG
CTGCGCTGGGAGTCCGCTAGACGAAATGAAGAGGCTGGAGAAGTTGCGTGAGCAAGACCCGGAGTCTGCAGCCAACTTGGTGGCCAACGGGAAGCTCCTC
GTCGATTTTACCCACGACGGGAATCTGCGTGCACTTCAATGTGCAGCTGAGCAGCTAGAGGAGGTACGACGACCTGCAACCACTTTCTTCCTTTTGTTTG
ACGCGGATCATGTCTTGACTGATACTCACTCATGACAGGGGCAAGTGCTCATGTTTTATGTCGTGCGGATGTTCCGCGAGGCCTGCTCGACGAGGAGACT
GGACATCCTGCGATTCCTGCTGCTCAATGGATTCGACCTCCAGCAAAGTTACACGCGAGATGCCTGCACGGGGTCATTGAGAGTATTGACAGTCCGCAAA
GAGCTGATGCTGTACAACCCCTCATTCGGTTTCTCCTGGACGCTGGCGTCGACGTCAATTGGCAGAGGAAGTCCGACCTGTACACGGCACTACACGTCGC
GTGCTGCAAGAACTTGTACCCCATCGTGTACTTGCTCGTTCTGTACGGCGCCGACGTGAATGCCATCGCTGCGGTGGGTATTAAAGTGATACAAATTGAG
TGCAAATATCGCTAGAAATGCTAACGCTGCTTTTGACTGCGATGCTGCAGGATGATGCCATGCCGCTCGCGTGTGCAAACAAAATTGGCGACACGAGCAC
TTTATCAGAAACTGAACAATCGCAGAAGGAAATGCTCGTGTCCTTTTTGGTGGAAAACCAAGCACGAGAGACCTGGAGAAGGCAACCACGTCGAGTTACT
CCAGCAGCGTCGATGAGTGCGAGCTCGCCCAGCCCAGAAGCTGGTGAATCTGCAGTAAGTCCAGTCAAACGACCGATCTTGAGCTTTTCGAGTAGTTTCG
GTATCCACTGTAGCATTGACGAACCGACAGACAACCAGCCCCAGGAAGGTCTCCGATTTGACACATCGGACACCTCCGAAAGCCTGTAGGCGTTTGCAAT
TAGGTGGTTTCACCAGCACCCGAGAAATGAGATGCAACAGAAACAAAAATACAAACTTGACTTGTTCAAGCTGTCCTTCAACCTGTGTCGGTCTCTTGCT
TTTCATAGCTCAGCATTCTTTGCATCTGCGCGGCTTCATCCTAGAACTTCTTACGAACCGCGGCATCACACATGTCGTGCAGCCTCATTGAGGCCAAGTT
CCAGGTGCTGGACCGCACCATCAGGATGTTGTCCAAGTCCAAAAGCTTGCGCACGCCGAAAGTCGCGTCGTCCGAGCAGCTTCGCGATCTTGTAGAAACC
CAGAAGCCGACCTCTCTTCTGCCGACGCTAAACGCTGTGAAGGGCGTAGTGGTGACACGAAACAACCAGACGTACCCGACCGGTGAGAAGACAAGTCGAT
CGCAGCCGAGTACTGCGCGCGAAGAGAAATCTGAAAAGAGATCAGGACACTCACCACCACGCCCAAGCACTGGGAGGAGAGATCCATACGAAAGCTCGAC
CGAACTGCTCCCAGACAAGTGGGTCGACCCAAAACAACGGCGAGCAGAGCAGCTTCTGCAGGAGACTTGGCATGTACGTCTCGGATTAGCTATCAGAGCG
ATACTATCACCTAACTGTATGGTTTGCACGGCAGGAAATCGAGTCTGCTGTAAACTGGGGTCAAGAATTGGGCTCTCCCACTCGAGAGGTAGGCTTGCGG
TTGGCAGTTCGAAGTCATGTGATCCTGACTAATTGAACGGCGATGTCATGCTCTAGGCGCTTCGGTCGAAGTTGCTCAACGAAAGTGTACAAGATGATCG
CCAAGAGCAAGAGTCGATATCAAGCCAGCGTCAACTACTAGAGCAATATGGATAACCAAATTAACGGCGATTCAGGTGAGCAATTAGACTATCGATTCAC
CAAACAGTTTGCTGACGCTGTTGCTGCTTCGACCCTTCTGTCTATTGGGCTATAGATGCACTTAGTGCTGCAGTGCACAACGCTTTGCCCCCACCAAAAC
GACCGCTGACATCAACGGGTTTGCAACCGAAGAAGAGCAA