Description :
From Genome Similarity Track
Location :
Scaffold_398:14967- 17496
Transcript NameFunction/comments
g13945.t1hypothetical protein

Sequence
2529 bases(100 bases per row)
ATCGTCACTGGATGTGTTTGCTGTGTGCGAATTGCACTCGATGAAGGAGGGACGCATTGAAACTGTCGAGAAGGTGTTCACTCAGTTTGTGGCCAAGTTT
TTGGCGGTGCTCAAAGTGACTGAGCAGTCTATCGGACAAAGCCTGAGCGATGACACTGCAGCGTCTCGGCTGCGGTCCATGCTTGCCTTCGTACTGGCCT
ACGTGGTGGAACTGCCGTCCGGGCGACTTGCTGCGTGCGCTGACCGTGATGATCTCGCCAGGCGCTTTGCCGTCCCGGCAAGCTCACAAATCGTAGCAGC
ATTGCGAGATGTCGTGAGCCTCGGAGAGCGGTCACGAGACCCATCTAGACTAGCGCCTTCGCCCTCCTAGGCCGCAACATGACAAACTAGAAGTGCACAA
TAGAATACATGTAACAATTACCCTATCGAGATCCAGAACTAACAAGCGTGGCTTTCACTACAGTGGACAAACCTACCAAGCCGTCTTACCAGCGCATTAA
GCAAACATATCTGTCTCCCACAACATGGAGTCACTGTCGACCTGCCCGAGTTCTTTGAGTACCTGACGAACTTGAGCGAGTGCGGCTCGCCCTCAGCAGC
GACAGCACATTGCTGAGCCACCACATCTCGCCAGTAAACGTCGGTGTGGCAAATCGCATCCAGCGGATGTCCGTTTCGATCGGTTGCAAAACGGATGAAG
CCTCTTGCTGACTCCACCGAGATGGCACTCCAGCCTGTAGCTCCATTCTCGATTTACACGTGGCGATGATAGAGACCCCAAAGCGACAGGAGTTCCCAGA
ACTCACGACAGCTCTCGTTGTCTGTCGCGAATGTCTCTCGAAGCGCAACGTGGGATCGCTGCCTCACGCCGTGACGCTTGTGGACCAGTACCTAGATCCG
TTCTCATCGCGCAAGAAAGTTGGGCGTGCGTGCAGATTGGGACTGCCGAGACGAGCACTGGAATATGCAGCAGCTCGCGACCCGGACTGGGCCAATGGCC
AGTACATGGCAGCGGCCGCTGTCATTCGAGGGTTCGTGCACGTCCTCGAATGGCTGAACGAGTGCTACCCAGGACGCACTTCATGGGGTGAAGGCCACGA
AGGATCGAGTCGCTGTGGACGATTCCTCATGGACACGGCAGCGGAACATGGCCATCTCCCTGTTATGCAGTGGTTGCATGCGAACCGCAGTGAAGGTTGC
ACGTATCGAGCCATGAACTACGCAGCAGCCAGTGGTCGACTAGATATGGTGCAGTGGATCCATGACAACCGCAGTGAGCCTTGCAGCACGGAGGCGATGG
ATTATGCTGCCGGGAAGGGCCACCTCGACGTTGTGCGCTTCCTACACGAAAACCGACCAGAAGGATGCACCAAACACGCCATGAGCAGTGCAGCGGCCAA
CGGCCACTTGGTCGTTGTGCAATGGCTCTACGCGAACCGGAGCGAGCGGATGCCGGCGAATGCGTTGCGTAGCGCCGCCAAGTATGGGCATCTTGAAGTG
GTCCAGTGGCTGGTTGAGATTGTCTGTAAAGAGTCCAGAGGGGACTCGTGTATCCAAGATGCGATCCGAATCGCATGTCAAGCAGGTCACGTCGAAGTGG
CACGGGACCTTGAGCAAACACTCAAGCAAATGTGACTCGAAGCTACCATACAACTTGACTAGTAGCCAGAATCTCGTTTCGACAAGGCGTGGCCAGCAAC
GCTATGACTCGAGAAAATAGAGGCTCAAACTTGAACAAATAAGGGAGATTGTATCATTCTTTATTGCGCCACTGATGTAGCTCAATCTCCAACATATTAC
TAGCAGTAAGCCATGTCACATCGGTTTCCTCTCTGAGTAAAAGCCATCCTCCATTTACTTGTTCTTCTGGTGTGGTGCTGTTATGGTATTGCAGTCTCCA
TTTGGCGAGAGCTGGAGCTGGGTTTGTCGGTTCGATGGTCGTCATAATGCCGAGGCATAAACCTTGGATCCTTTTGGTGTCGCTTCGTTTCCACATGCTT
GCTATTGCCATAACTTGGTACGTTCCAGCTGCTTCGTATCCTGGATTGAGATTTCTTCATCCTCAAATTCAACGGTACATGTTCATGTTCAAGCTCAAGC
GCGTGCACTGCGTTGACACCGCTGCTGTGATCCCCCTCCAGCACAGCCACGCCCGTGTATCTCCGTACATGCTGACCAGCCACACCCCGCGCGAAAACAG
CCCTTCTCGTCAACCCGAATGGCCGCCAACGAGTGAAGGGGTGTCACGCCAGAGCAGCCCTTCTCCTCAGTCCGGATTGTCGCCGACGAGTGAAGAAGCG
CCTGCTCCAGCGGGACAGACGGTAAGTTCAATGACTGTACCAGCCACAGTGGTTCTGTGCAACGGCGGCTCCTTCGGCGACCCAGGCAACAAGTGGCTCC
TACGACAACAGGATATATTATACAGCTACACATGTTGGGCTTTACCAACAGCTTGAACGGCCCATCGTGAAGTCATCGCCCATCGTGAAGTCATCGATCA
ACCAGCGTGATATGTCAGCTGAATGATAT